Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-452-v2_5p (mature (guide)) URS0000587A5B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-452: Hsa-mir-452 is specifically downregulated by shPIAS2_49 transfection and targets genes ST8SIA2 and ZNF532 [PMC5158200]. In endometrial cancer (EC) tissues, hsa-mir-452 is one of the significantly upregulated miRNAs [PMC3678876]. In a study on acute myeloid leukemia (AML) patients, hsa-mir-452 was identified as a protective factor for survival time [PMC5634225]. Hsa-mir-452 was found to be significantly downregulated in adipose tissue compared to normal tissue [PMC8986441]. Hsa-mir-452, along with hsa-mir-29a, hsa-mir-29b, and hsa-mir-29c, synergistically regulated the gene NAV3 [PMC3878884]. The function of hsa-miR-371-3p and hsa-mir-452 in hypertrophic cardiomyopathy (HCM) has not been clarified yet, but they share the same targets as hsa-miR-373 [PMC8200816]. Hsa-mir-4713 and hsa-mir-452 were found to interact with NPY1R [PMC8986441]. The lentivirus vector for introducing hsa-miR-452 was purchased from GeneCopoeia for experimental purposes [PMC5596211].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUUGCAGAGGAAACUGAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications