Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3926 URS0000576DFF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3926: Hsa-mir-3926 is a microRNA that has been studied in various contexts [PMC8176021]. In a study on prognostic prediction models for cancer, hsa-mir-3926 was one of the 13 molecular features used to calculate the risk score for 3-year survival [PMC8176021]. Another study identified hsa-mir-3926 as one of the miRNAs associated with hsa_circ_0009910 [PMC7824949]. Additionally, in a study on miRNA interactions, hsa-mir-3926 was found to exhibit moderate interactions with other miRNAs [PMC8942883]. In a different study, hsa-mir-3926 was identified as one of the downregulated miRNAs in a specific condition [PMC8973762]. Finally, in a study on genes controlled by different miRNAs, hsa-mir-3926 was found to regulate the BTG2 gene along with another miRNA [PMC8021574].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCCAAAAAGCAGGCAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications