v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Brenneria izbisi tRNA-Met secondary structure diagram

Brenneria izbisi tRNA-Met URS000057545F_2939450

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGCGGGGUGGAGCAGCCCGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Aeromonas bivalvium tRNA-Met
  2. Aeromonas dhakensis tRNA-Met
  3. Aeromonas hydrophila tRNA-Met
  4. Aeromonas sp. 43P tRNA-Met
  5. Aeromonas veronii (Aeromonas ichthiosmia) tRNA-Met
  6. Brenneria nigrifluens DSM 30175 = ATCC 13028 tRNA-Met
  7. Brenneria nigrifluens tRNA-Met
  8. Brenneria salicis ATCC 15712 = DSM 30166 tRNA-Met
  9. Brenneria sp. EniD312 tRNA-Met
  10. Brenneria sp. HEZEL_4_2_4 tRNA-Met
  11. Brenneria sp. L3-3C-1 tRNA-Met
  12. Brenneria sp. L3_3C_1 tRNA-Met
  13. Buttiauxella sp. tRNA-Met
  14. Enterobacter hormaechei tRNA-Met
  15. Escherichia coli 3-105-05_S4_C1 tRNA-Met
  16. Escherichia coli 4.0967 tRNA-Met
  17. Escherichia coli KTE130 tRNA-Met
  18. Escherichia coli MS 196-1 tRNA-Met
  19. Klebsiella michiganensis tRNA-Met
  20. Klebsiella pneumoniae subsp. pneumoniae tRNA-Met
  21. Klebsiella pneumoniae tRNA-Met
  22. Klebsiella quasipneumoniae tRNA-Met
  23. Leclercia pneumoniae tRNA-Met
  24. Leminorella grimontii ATCC 33999 = DSM 5078 tRNA-Met
  25. Leminorella grimontii tRNA-Met(cat)
  26. Leminorella richardii tRNA-Met(cat)
  27. Pseudobdellovibrio sp. tRNA-Met
  28. Escherichia coli K-12 P-site tRNA fMet from Escherichia coli K-12 (PDB 5UQ7, chain y)
  29. Homo sapiens P-site tRNA from Homo sapiens (PDB 8G5Y, chain Pt)
  30. Escherichia coli RNA (77-MER) from Escherichia coli (PDB 8G61, chain Pt)
  31. Salmonella enterica subsp. enterica serovar Javiana tRNA-Met
  32. Salmonella enterica subsp. enterica tRNA-Met
  33. Salmonella enterica tRNA-Met
  34. Serratia aquatilis tRNA-Met
  35. Serratia proteamaculans tRNA-Met
  36. Serratia quinivorans tRNA-Met(cat)
  37. Saccharomyces cerevisiae S288C tRNA (77-MER) from Saccharomyces cerevisiae S288C (PDB 8ZGR, chain Ta)
  38. Escherichia coli str. K-12 substr. MDS42 TRNA-FMET from Escherichia coli str. K-12 substr. MDS42 (PDB 4V87, chain BD)
  39. Thermus thermophilus HB8 tRNA-fMet from Thermus thermophilus HB8 (PDB 5E81, chain 2K)
  40. Saccharomyces cerevisiae tRNA from Saccharomyces cerevisiae (PDB 9F9S, chain DQ)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...