Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Serratia quinivorans tRNA-Met(cat) secondary structure diagram

Serratia quinivorans tRNA-Met(cat) URS000057545F_137545

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCGGGGUGGAGCAGCCCGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Aeromonas bivalvium tRNA-Met
  2. Aeromonas crassostreae tRNA-Met
  3. Aeromonas dhakensis tRNA-Met
  4. Aeromonas hydrophila subsp. ranae tRNA-Met
  5. Aeromonas hydrophila tRNA-Met
  6. Aeromonas sobria tRNA-Met
  7. Aeromonas sp. 43P tRNA-Met
  8. Aeromonas veronii (Aeromonas ichthiosmia) tRNA-Met
  9. Brenneria izbisi tRNA-Met
  10. Brenneria nigrifluens DSM 30175 = ATCC 13028 tRNA-Met
  11. Brenneria nigrifluens tRNA-Met
  12. Brenneria salicis ATCC 15712 = DSM 30166 tRNA-Met
  13. Brenneria sp. EniD312 tRNA-Met
  14. Brenneria sp. hezel4-2-4 tRNA-Met
  15. Brenneria sp. HEZEL_4_2_4 tRNA-Met
  16. Brenneria sp. L3-3C-1 tRNA-Met
  17. Brenneria sp. L3_3C_1 tRNA-Met
  18. Buttiauxella sp. tRNA-Met
  19. Enterobacter hormaechei tRNA-Met
  20. Escherichia albertii tRNA-Met
  21. Escherichia coli 3-105-05_S4_C1 tRNA-Met
  22. Escherichia coli 4.0967 tRNA-Met
  23. Escherichia coli KTE130 tRNA-Met
  24. Escherichia coli MS 196-1 tRNA-Met
  25. Escherichia coli O21 tRNA-Met
  26. Escherichia coli O51:H10 tRNA-Met
  27. Klebsiella michiganensis tRNA-Met
  28. Klebsiella pasteurii tRNA-Met
  29. Klebsiella pneumoniae subsp. pneumoniae tRNA-Met
  30. Klebsiella pneumoniae tRNA-Met
  31. Klebsiella quasipneumoniae tRNA-Met
  32. Leclercia pneumoniae tRNA-Met
  33. Leminorella grimontii ATCC 33999 = DSM 5078 tRNA-Met
  34. Leminorella grimontii tRNA-Met(cat)
  35. Leminorella richardii tRNA-Met(cat)
  36. Heterocephalus glaber P/E tRNA (77-MER) from Heterocephalus glaber (PDB 9Y42, chain Cc)
  37. Pseudobdellovibrio sp. tRNA-Met
  38. Escherichia coli K-12 P-site tRNA fMet from Escherichia coli K-12 (PDB 5UQ7, chain y)
  39. Homo sapiens P-site tRNA of the stalled 80S from Homo sapiens (PDB 9RPV, chain B5)
  40. Escherichia coli RNA (77-MER) from Escherichia coli (PDB 8G61, chain Pt)
  41. Salmonella enterica subsp. enterica serovar Javiana tRNA-Met
  42. Salmonella enterica subsp. enterica tRNA-Met
  43. Salmonella enterica tRNA-Met
  44. Serratia aquatilis tRNA-Met
  45. Serratia proteamaculans tRNA-Met
  46. Saccharomyces cerevisiae S288C tRNA (77-MER) from Saccharomyces cerevisiae S288C (PDB 8ZGR, chain Ta)
  47. Ctenomyidae tRNA (78-MER) from Ctenomyidae (PDB 9Y4G, chain Cc)
  48. Escherichia coli str. K-12 substr. MDS42 TRNA-FMET from Escherichia coli str. K-12 substr. MDS42 (PDB 4V87, chain BD)
  49. Thermus thermophilus HB8 tRNA-fMet from Thermus thermophilus HB8 (PDB 5E81, chain 2K)
  50. Cavia porcellus tRNA from Cavia porcellus (PDB 9Y4H, chain Cw)
  51. Saccharomyces cerevisiae tRNA from Saccharomyces cerevisiae (PDB 9F9S, chain DQ)
  52. Yersinia ruckeri tRNA-Met
Relationships

Molecular Relationships

2D structure

Loading 2D structure...