Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-181b URS0000574E81_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-181b: Bta-mir-181b is a miRNA that is significantly upregulated in cows with mastitis compared to healthy cows [PMC6107498]. It is one of the 123 mastitis-related miRNAs that experience upregulation in mastitis [PMC6107498]. Bta-mir-181b is also found to be a target of the novel_circ_0006981 [PMC7230347]. It is encoded in an intergenic region of the Bos taurus genome [PMC5384155]. Bta-mir-181b, along with other differentially regulated miRNAs, has been associated with cellular proliferation or apoptosis [PMC5384155]. It is located on chromosome #16 along with bta-miR-34a and bta-miR-205 [PMC5384155]. The ViTa algorithm suggests that bta-mir-181b could potentially target the genome [PMC5384155]. Bta-mir-181b, along with other miRNAs, has been found to be clustered in this study [PMC5384155]. In serum from persistently infected cattle, bta-mir-181b was significantly down-regulated compared to healthy cattle [PMC5384155]. Bta-mir-181b has been associated with immune modulatory functions along with other miRNAs such as bta-miR-26b and bta-miR-34a [PMC5384155]. Bta-miR-181a, which belongs to the same family as bta-mir-181b, has been reported to regulate milk lipid synthesis by targeting ACSL1 enzyme in bovine milk biosynthesis [PMC6637853].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAUUGCUGUCGGUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis (American alligator) ami-miR-181b-5p
  2. Anolis carolinensis (green anole) Aca-Mir-181-P2b_5p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-484596
  4. Callorhinchus milii Cmi-Mir-181-P2b_5p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-181-P2b_5p (mature (guide))
  6. Cavia porcellus cpo-miR-181b-5p
  7. Chrysemys picta bellii Cpi-Mir-181-P2b_5p (mature (guide))
  8. Chrysemys picta cpi-miR-181b-5p
  9. Columba livia cli-miR-181b-5p
  10. Danio rerio (zebrafish) Dre-Mir-181-P2c1_5p (mature (guide))
  11. Dasypus novemcinctus dno-miR-181b-5p
  12. Drosophila erecta Drosophila_erecta piRNA piR-der-12904
  13. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21035062
  14. Echinops telfairi Ete-Mir-181-P2b_5p (mature (guide))
  15. Gadus morhua gmo-miR-181b-5p
  16. Gallus gallus Gga-Mir-181-P2b_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-181-P2b_5p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-181b (MIR181B)
  19. Gorilla gorilla (western gorilla) ggo-miR-181b
  20. Hippoglossus hippoglossus hhi-miR-181b
  21. Homo sapiens Hsa-Mir-181-P2b_5p (mature (guide))
  22. Lagothrix lagotricha lla-miR-181b
  23. Latimeria chalumnae (coelacanth) Lch-Mir-181-P2b_5p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-181-P2b_5p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) mml-miR-181b-5p
  26. Macaca nemestrina mne-miR-181b
  27. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-181-P2b_5p (mature (guide))
  28. Monopterus albus (swamp eel) Mal-Mir-181-P2b2_5p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-181b-5p
  30. Ornithorhynchus anatinus Oan-Mir-181-P2a_5p (mature (guide))
  31. Oryctolagus cuniculus (rabbit) ocu-miR-181b-5p
  32. Oryzias latipes (Japanese medaka) ola-miR-181b-5p
  33. Pan paniscus (pygmy chimpanzee) ppa-miR-181b
  34. Pan troglodytes microRNA mir-181b-1
  35. Pongo pygmaeus (Bornean orangutan) microRNA mir-181b-1
  36. Pteropus alecto pal-miR-181b-5p
  37. Python bivittatus Pbv-Mir-181-P2b_5p (mature (guide))
  38. Rattus norvegicus (Norway rat) Rno-Mir-181-P2b_5p (mature (guide))
  39. Sarcophilus harrisii Sha-Mir-181-P2a_5p (mature (guide))
  40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P2b_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-181-P2c3_5p (mature (guide))
  42. Sus scrofa ssc-miR-181b
  43. Taeniopygia guttata (zebra finch) tgu-miR-181b-5p
  44. Xenopus laevis (African clawed frog) Xla-Mir-181-P2b3_5p (mature (guide))
  45. Xenopus tropicalis Xtr-Mir-181-P2b_5p (mature (guide))
Publications