Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-107 URS00005743AE_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, IntAct, ENA, GeneCards, MirGeneDB, TarBase, MalaCards, LncBase, miRBase). Described in 69 papers. Homo sapiens (human) hsa-miR-107 sequence is a product of MIR107, hsa-miR-107, 107, miR-107 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 11B6, 13CDNA73, 156DAG, 15E1.2, 16.3A5, 16E1BP, 182-FIP, 1A1-3B, 2-COP, 20D7-FC4.

Interactions 5

According to IntAct, Homo sapiens (human) hsa-miR-107 interacts with:

IntAct ID Participant Synonyms
EBI-22224713 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22197914 URS00004656A3_9606 EBI-22197900 URS00004656A3_9606 lnc_linc02605
EBI-22224849 URS00004656A3_9606 EBI-22197900 URS00004656A3_9606 lnc_linc02605
EBI-22227452 URS00004656A3_9606 EBI-22197900 URS00004656A3_9606 lnc_linc02605
EBI-22227200 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCAGCAUUGUACAGGGCUAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-103-P3_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-103-P3_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-103-P3_3p (mature (guide))
    5. Capra hircus (goat) miR-107
    6. Cavia porcellus cpo-miR-107-3p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P3_3p (mature (guide))
    8. Columba livia Cli-Mir-103-P3_3p (mature (guide))
    9. Danio rerio dre-miR-107a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-107-3p
    11. Echinops telfairi Ete-Mir-103-P3_3p (mature (guide))
    12. Equus caballus eca-miR-107b
    13. Gallus gallus (chicken) gga-miR-107-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-107
    15. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-107
    16. Lagothrix lagotricha lla-miR-107
    17. Macaca mulatta (Rhesus monkey) mml-miR-107-3p
    18. Macaca nemestrina (pig-tailed macaque) mne-miR-107
    19. Monodelphis domestica mdo-miR-107
    20. Mus musculus (house mouse) mmu-miR-107-3p
    21. Ophiophagus hannah (king cobra) oha-miR-107-3p
    22. Ornithorhynchus anatinus (platypus) Oan-Mir-103-P3_3p (mature (guide))
    23. Oryctolagus cuniculus (rabbit) ocu-miR-107-3p
    24. Ovis aries miscellaneous RNA
    25. Pan paniscus ppa-miR-107
    26. Pan troglodytes ptr-miR-107
    27. Pongo pygmaeus (Bornean orangutan) ppy-miR-107
    28. Rattus norvegicus rno-miR-107-3p
    29. Sarcophilus harrisii Sha-Mir-103-P3_3p (mature (guide))
    30. Scyliorhinus torazame Sto-Mir-103-P3_3p (mature (guide))
    31. Sus scrofa ssc-miR-107
    32. Taeniopygia guttata (zebra finch) tgu-miR-107
    33. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-107
    34. Tor tambroides (Thai mahseer) miR-107a-3p
    35. Xenopus tropicalis (tropical clawed frog) xtr-miR-107