Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-miR-107 URS00005743AE_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-103-P1_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-103-P1_3p (mature (guide))
  3. Bos taurus Bta-Mir-103-P1_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-103-P1_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-103-P1_3p (mature (guide))
  6. Capra hircus miR-107
  7. Cavia porcellus cpo-miR-107-3p
  8. Chrysemys picta bellii Cpi-Mir-103-P1_3p (mature (guide))
  9. Columba livia Cli-Mir-103-P1_3p (mature (guide))
  10. Danio rerio (zebrafish) dre-miR-107a-3p
  11. Dasypus novemcinctus dno-miR-107-3p
  12. Echinops telfairi Ete-Mir-103-P1_3p (mature (guide))
  13. Equus caballus (horse) eca-miR-107b
  14. Gallus gallus gga-miR-107-3p
  15. Gekko japonicus Gja-Mir-103-P1_3p (mature (guide))
  16. Gorilla gorilla gorilla ggo-miR-107 (MIR107)
  17. Gorilla gorilla (western gorilla) ggo-miR-107
  18. Homo sapiens hsa-miR-107
  19. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-107
  20. Lagothrix lagotricha lla-miR-107
  21. Latimeria chalumnae (coelacanth) Lch-Mir-103-P1_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-103-P1_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-107-3p
  24. Macaca nemestrina mne-miR-107
  25. Microcaecilia unicolor Mun-Mir-103-P4_3p (mature (guide))
  26. Monodelphis domestica (gray short-tailed opossum) mdo-miR-107
  27. Monopterus albus (swamp eel) Mal-Mir-103-P1a_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-107-3p
  29. Ophiophagus hannah (king cobra) oha-miR-107-3p
  30. Ornithorhynchus anatinus Oan-Mir-103-P1_3p (mature (guide))
  31. Oryctolagus cuniculus (rabbit) ocu-miR-107-3p
  32. Ovis aries miscellaneous RNA
  33. Pan troglodytes ptr-miR-107
  34. Pongo pygmaeus (Bornean orangutan) ppy-miR-107
  35. Rattus norvegicus (Norway rat) rno-miR-107-3p
  36. Sarcophilus harrisii Sha-Mir-103-P1_3p (mature (guide))
  37. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P1_3p (mature (guide))
  38. Sphenodon punctatus Spt-Mir-103-P1_3p (mature (guide))
  39. Sus scrofa ssc-miR-107
  40. Taeniopygia guttata (zebra finch) tgu-miR-107
  41. Tetraodon nigroviridis tni-miR-107
  42. Tor tambroides miR-107a-3p
  43. Xenopus laevis (African clawed frog) Xla-Mir-103-P1c_3p (mature (guide))
  44. Xenopus tropicalis xtr-miR-107
Publications