Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR171i-3p URS000056E087_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR171i-3p: Osa-mir171i-3p is a microRNA that has been studied in relation to its target genes and their expression levels. In a study, the expression levels of several target genes were authenticated for different miRNAs, including osa-mir171i-3p [PMC8472271]. The study observed the expected opposing expression relationships between miRNAs and their target genes, including osa-mir171i-3p and its target gene MSH3 [PMC8472271]. Another gene of interest is XPC, which is predicted to be a target gene of gma-miR167i and is involved in DNA damage recognition during global genomic repair [PMC8472271]. The study suggests that gma-miR167i, osa-mir171i-3p, and mtr-miR395a may play important roles in the DNA repair process in rice [PMC8472271]. The expression levels of gma-miR167i, osa-mir171i-3p, and mtr-miR395a show contrasting patterns compared to their predicted target genes XPC, MSH3, and RAD51B [PMC8472271]. The relative transcript levels of several miRNAs were found to be similar to the sequencing results, including osa-mir171i-3p. However, some miRNAs showed contrasting expression patterns compared to the sequencing results [PMC8472271]. Additionally, the study confirmed a 3 nt shift for osa-mir171-i3p and found a higher expression level for this microRNA [PMC4570225].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUUGAGCCGCGUCAAUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Ananas comosus microRNA 171h
  2. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR171i-3p
  3. Sorghum bicolor sbi-miR171h
  4. Zea mays (maize) zma-miR171m-3p
Publications