Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-135a precursor (hsa-mir-135a-1) URS00005675D3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR135A1: MIR135A1 is a member of the miR135a family in mice [PMC3861205]. It is located in the human chromosome 3p21.2 region [PMC10101835]. This region contains not only well-known protein-coding tumor suppressor genes (TSGs) like TP53 but also six microRNAs, including MIR135A1 [PMC5001246]. MIR135A1 is under regulatory control of NIR17 and MIR135B [PMC3948699]. The promoter region of the MIR135A1 gene does not show differential methylation status between different clusters [PMC9885701]. The CNVs (copy number variations) of the genes encoding miR-135a-5p transcript, including MIR135A1, do not show significantly different frequencies of alteration between clusters [PMC9885701]. Promoter sequences of the MIR135A1 gene were retrieved from UCSC using R/Bioconductor packages BSgenome.Hsapiens.UCSC.hg19 [PMC9885701]. Transcription factor binding sites were searched in the promoter sequences of both MIR135A1 and MIR135A2 genes to understand their transcriptional regulation [PMC9885701]. MiR-135a is encoded by two genes: MIR135A1 on human chromosome 3 and MIR135A2 on human chromosome 12 [PMC9160269]. MiR-135b is encoded by the MIR135B gene located on human chromosome 1q32.1 [PMC7476096]. Frequent deletion or amplification of the loci for miR-135, including MIR135A1, MIR135A2, and MIR135B, may be associated with dysregulation of certain members of this family and poor prognosis in primary breast cancers [PMC9486161].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGCGCACGGCGGGGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications