v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000016813.1) URS00005675D3_61621

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGCGCACGGCGGGGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aotus nancymaae miRNA (ENSANAG00000013266.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-135 precursor (age-mir-135-1)
  3. Cercocebus atys miRNA (ENSCATG00000018668.1)
  4. Chlorocebus sabaeus (African green monkey) microRNA 135a-1 (ENSCSAG00000026140.1)
  5. Gorilla gorilla gorilla microRNA 135a-1 (ENSGGOG00000029575.2)
  6. Homo sapiens microRNA hsa-mir-135a precursor (hsa-mir-135a-1)
  7. Lagothrix lagotricha microRNA lla-mir-135 precursor (lla-mir-135-1)
  8. Macaca fascicularis microRNA 135a-1 (ENSMFAG00000004266.2)
  9. Macaca mulatta microRNA mml-mir-135a precursor (mml-mir-135a-1)
  10. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009426.1)
  11. Pan troglodytes ptr-mir-135a-1 (ENSPTRG00000027627.2)
  12. Papio anubis (olive baboon) miRNA (ENSPANG00000002922.3)
  13. Pongo abelii microRNA 135a-1 (ENSPPYG00000021866.2)
  14. Pongo pygmaeus microRNA ppy-mir-135a precursor (ppy-mir-135a-1)
  15. Rhinopithecus roxellana miRNA (ENSRROG00000026727.1)