Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR160a-5p URS000055B49A_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR160c-5p: Osa-mir160c-5p is a type of microRNA that has been studied in various contexts [PMC7037501]. In a study on rice immunity, it was found that osa-mir160c-5p was increased in the IRBB5 genotype, while other genotypes showed decreased expression or slight fluctuation [PMC7037501]. Another study measured the accumulation of six miRNAs, including osa-mir160c-5p, in response to treatment over time and found that their expression trends were consistent with small RNA-seq data [PMC7037501]. Osa-mir160c-5p has been shown to target four members of the ARF transcription factors [PMC4448008]. In Bermuda grass under combined cold and salt stresses, osa-mir160c-5p was down-regulated [PMC9496875]. Osa-mir160c-5p has also been found to target ARF6 and ARF8 in rice leaves during grain-filling stages [PMC4257594]. Additionally, osa-mir160c-5p has been identified as a member of the osa-miR160 family with six miRNA members [PMC9737669]. Overall, these studies highlight the role of osa-mir160c-5p in various biological processes and its potential as a target for further investigation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGUAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Aegilops tauschii ata-miR160b-5p
  2. Amborella trichopoda atr-miR160
  3. Ananas comosus microRNA 160a
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR160b
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR160b-5p
  6. Arabidopsis thaliana ath-miR160a-5p
  7. Asparagus officinalis aof-miR160c
  8. Brachypodium distachyon bdi-miR160b-5p
  9. Brassica napus (rape) bna-miR160a
  10. Brassica rapa bra-miR160a-5p
  11. Carica papaya (papaya) cpa-miR160c-5p
  12. Corchorus olitorius ahy-miR160-
  13. Cucumis melo (muskmelon) cme-miR160a
  14. Cynara cardunculus (wild artichoke) cca-miR160b
  15. Eugenia uniflora (Brazil-cherry) eun-miR160-5p
  16. Fragaria vesca subsp. vesca fve-miR160b
  17. Glycine max gma-miR160f
  18. Helianthus annuus (common sunflower) ath-miR160a-5p
  19. Hordeum vulgare microRNA160a
  20. Linum usitatissimum (flax) lus-miR160e
  21. Lolium arundinaceum (tall fescue) far-miR160
  22. Malus domestica (apple) mdm-miR160c
  23. Manihot esculenta mes-miR160d
  24. Marchantia polymorpha subsp. ruderalis non-coding RNA
  25. Medicago truncatula mtr-miR160a
  26. Nicotiana tabacum nta-miR160a
  27. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160b-5p
  28. Pachycladon cheesemanii Pch-miR160a
  29. Physcomitrium patens ppt-miR160a
  30. Picea abies pab-miR160d
  31. Populus tomentosa Pto-miR160d
  32. Populus trichocarpa (black cottonwood) ptc-miR160c-5p
  33. Prunus persica ppe-miR160a
  34. Ricinus communis (castor bean) rco-miR160b
  35. Selaginella moellendorffii smo-miR160b
  36. Solanum lycopersicum sly-miR160a
  37. Solanum tuberosum (potato) stu-miR160b
  38. Sorghum bicolor sbi-miR160b
  39. Theobroma cacao (cacao) tcc-miR160b
  40. Triticum aestivum tae-miR160
  41. Triticum turgidum (poulard wheat) ttu-miR160
  42. Vigna unguiculata vun-miR160
  43. Vitis vinifera vvi-miR160d
  44. Zea mays (maize) zma-miR160g-5p
Publications