Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica rapa (field mustard) bra-miR160a-5p URS000055B49A_3711

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bra-miR160a-5p: Bra-mir160a-5p is a microRNA that is abundantly expressed in plants, specifically in flower buds. It has been found to be downregulated under heat stress conditions [PMC7140848]. The targets of differentially expressed miRNAs, including bra-mir160a-5p, in response to heat stress include various proteins involved in stress response and signaling pathways [PMC7140848]. In terms of expression levels, bra-mir160a-5p has been found to have a high number of reads in flower buds [PMC6797766]. It is one of the top abundantly expressed miRNAs along with bra-miR159a and bra-miR171e [PMC6797766]. In another study, bra-mir160a-5p was also found to have high expression levels along with other miRNAs such as bra-miR159a and P-bra-miR319b-p3 [PMC3936892]. Overall, the research suggests that bra-mir160a-5p plays a significant role in plant development and response to heat stress.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGUAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Aegilops tauschii ata-miR160b-5p
  2. Amborella trichopoda atr-miR160
  3. Ananas comosus microRNA 160a
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR160b
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR160b-5p
  6. Arabidopsis thaliana ath-miR160a-5p
  7. Asparagus officinalis aof-miR160c
  8. Brachypodium distachyon bdi-miR160b-5p
  9. Brassica napus (rape) bna-miR160a
  10. Carica papaya (papaya) cpa-miR160c-5p
  11. Corchorus olitorius ahy-miR160-
  12. Cucumis melo (muskmelon) cme-miR160a
  13. Cynara cardunculus (wild artichoke) cca-miR160b
  14. Eugenia uniflora (Brazil-cherry) eun-miR160-5p
  15. Fragaria vesca subsp. vesca fve-miR160b
  16. Glycine max gma-miR160f
  17. Helianthus annuus (common sunflower) ath-miR160a-5p
  18. Hordeum vulgare microRNA160a
  19. Linum usitatissimum (flax) lus-miR160e
  20. Lolium arundinaceum (tall fescue) far-miR160
  21. Malus domestica (apple) mdm-miR160c
  22. Manihot esculenta mes-miR160d
  23. Marchantia polymorpha subsp. ruderalis non-coding RNA
  24. Medicago truncatula mtr-miR160a
  25. Nicotiana tabacum nta-miR160a
  26. Oryza sativa (Asian cultivated rice) osa-miR160a-5p
  27. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160b-5p
  28. Pachycladon cheesemanii Pch-miR160a
  29. Physcomitrium patens ppt-miR160a
  30. Picea abies pab-miR160d
  31. Populus tomentosa Pto-miR160d
  32. Populus trichocarpa (black cottonwood) ptc-miR160c-5p
  33. Prunus persica ppe-miR160a
  34. Ricinus communis (castor bean) rco-miR160b
  35. Selaginella moellendorffii smo-miR160b
  36. Solanum lycopersicum sly-miR160a
  37. Solanum tuberosum (potato) stu-miR160b
  38. Sorghum bicolor sbi-miR160b
  39. Theobroma cacao (cacao) tcc-miR160b
  40. Triticum aestivum tae-miR160
  41. Triticum turgidum (poulard wheat) ttu-miR160
  42. Vigna unguiculata vun-miR160
  43. Vitis vinifera vvi-miR160d
  44. Zea mays (maize) zma-miR160g-5p
Publications