Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saguinus labiatus (red-chested mustached tamarin) sla-miR-23a URS00005540D2_78454

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Anolis carolinensis aca-miR-23a-3p
  2. Ateles geoffroyi age-miR-23a
  3. Capra hircus (goat) chi-miR-23a
  4. Cervus elaphus cel-miR-23a
  5. Chrysemys picta (Painted turtle) cpi-miR-23a-3p
  6. Cricetulus griseus cgr-miR-23a-3p
  7. Cyprinus carpio ccr-miR-23a
  8. Equus caballus eca-miR-23a
  9. Gorilla gorilla gorilla ggo-miR-23a (MIR23A)
  10. Gorilla gorilla (western gorilla) ggo-miR-23a
  11. Homo sapiens hsa-miR-23a-3p
  12. Ictalurus punctatus ipu-miR-23a
  13. Lemur catta (Ring-tailed lemur) lca-miR-23a
  14. Lepisosteus oculatus (spotted gar) Loc-Mir-23-P1_3p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-23a-3p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-23a
  17. Mus musculus (house mouse) mmu-miR-23a-3p
  18. Ovis aries (sheep) miscellaneous RNA
  19. Pan paniscus ppa-miR-23a
  20. Pan troglodytes ptr-miR-23a
  21. Papio hamadryas pha-miR-23a
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-23a
  23. Pundamilia nyererei pny-miR-23a
  24. Python bivittatus (Burmese python) pbv-miR-23a-3p
  25. Rattus norvegicus rno-miR-23a-3p
  26. Salmo salar ssa-miR-23a-3p
  27. Sus scrofa ssc-miR-23a
  28. Tursiops truncatus (common bottlenose dolphin) miR-23a
  29. Xenopus laevis xla-miR-23a
  30. Xenopus tropicalis xtr-miR-23a