Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-100 precursor URS000054969A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR100: MIR100 is a microRNA that has been studied in various contexts. In a study using the Akaike information criteria, the combination of CD146 and CD144 among the extracellular vesicle (EV) membrane proteins, along with MIR100 and miR194, showed high multivariate AUROC values of 0.922 and 0.970, respectively [PMC8821147]. Additionally, an miR-100 expression vector called pBABE MIR100 was constructed using the pBABE-puro retrovirus vector [PMC9873580]. MiR101 was found to regulate Rab1a formation, while MIR100 and miR101 (along with miR15b, miR20a, miR92a, and miR132) were found to play a role in apoptosis by targeting inhibitors of the intrinsic apoptosis pathway [PMC7123062]. These findings highlight the importance of MIR100 in various biological processes and its potential as a therapeutic target or biomarker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications