v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) Oryctolagus_cuniculus piRNA piR-ocu-330774 URS000053F5B2_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCCAGUUUUCCCAGGAAUCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-922983
  2. Drosophila erecta Drosophila_erecta piRNA piR-der-386669
  3. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21220027
  4. Gallus gallus gga-miR-145-5p
  5. Gorilla gorilla gorilla ggo-miR-145 (MIR145)
  6. Gorilla gorilla (western gorilla) ggo-miR-145
  7. Macaca mulatta (Rhesus monkey) mml-miR-145-5p
  8. Macaca nemestrina mne-miR-145
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-6057329
  10. Ophiophagus hannah (king cobra) oha-miR-145-5p
  11. Pan troglodytes ptr-miR-145
  12. Pongo pygmaeus ppy-miR-145
  13. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63020
  14. Sus scrofa ssc-miR-145-5p
  15. Xenopus tropicalis xtr-miR-145