Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-6057329 URS000053F5B2_10090

• 24 nucleotides
• 2 databases (ENA, PirBase)
• Found in 15 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GUCCAGUUUUCCCAGGAAUCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-922983
2. Drosophila erecta Drosophila_erecta piRNA piR-der-386669
3. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21220027
4. Gallus gallus gga-miR-145-5p
5. Gorilla gorilla gorilla ggo-miR-145 (MIR145)
6. Gorilla gorilla (western gorilla) ggo-miR-145
7. Macaca mulatta (Rhesus monkey) mml-miR-145-5p
8. Macaca nemestrina mne-miR-145
9. Ophiophagus hannah (king cobra) oha-miR-145-5p
10. Oryctolagus cuniculus Oryctolagus_cuniculus piRNA piR-ocu-330774
11. Pan troglodytes ptr-miR-145
12. Pongo pygmaeus ppy-miR-145
13. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63020
14. Sus scrofa ssc-miR-145-5p
15. Xenopus tropicalis xtr-miR-145

Download

• FASTA
• JSON