Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1469 URS0000539433_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1469: Hsa-mir-1469 is one of the nine miRNAs that were significantly upregulated by ACBP-3 and selected for further analysis [PMC5034486]. Hsa-mir-1469 has been associated with the overall survival of patients with pancreatic ductal adenocarcinoma (PDAC) [PMC8613738]. It has also been shown to induce apoptosis in cancer cells [PMC9221798]. Hsa-mir-1469, along with hsa-miR-133a-5p and hsa-miR-10b-5p, may play important roles in the protective effect of icariin against glucocorticoid-induced injury [PMC9221798]. The expression of hsa-mir-1469 was found to be downregulated in resting samples from various cell types compared to HIV-negative samples [PMC4865051]. Hsa-mir-1469 has also been implicated in the regulation of PRAS40 levels and cancer cell migration and invasion [PMC9389164]. It is upregulated by ATF4 signals and leucine deprivation, suggesting its involvement in cellular stress responses [PMC9389164]. Hsa-mir-1469 may serve as a potential biomarker for thyroid disorders (TDs) diagnosis, as its expression was found to be downregulated in plasma samples from patients with TDs compared to healthy controls [PMC9312839]. Additionally, hsa-mir-1469 has been associated with pancreatic cancer prognosis and primary resistance to EGFR-TKI treatment [PMC8809919] [PMC5687624]. The expression of hsa-miR-3960, hsa-miR-4497, hsa-miR-3665, hsa-miR4787–5p, miR17 and miR221/222 miRNA clusters was comparatively high compared to other miRNAs [PMC5029934]. Hsa-mir-1469 has a high GC content [PMC2774487].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCGGCGCGGGGCGCGGGCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pongo pygmaeus ppy-miR-1469
Publications