Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus sp. FSL M8-0359 tRNA-Gly secondary structure diagram

Bacillus sp. FSL M8-0359 tRNA-Gly URS00005115FB_2921624

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,614 other species

  1. Abyssicoccus albus tRNA-Gly
  2. Acinetobacter radioresistens tRNA-Gly
  3. Aeribacillus alveayuensis tRNA-Gly
  4. Aeribacillus composti tRNA-Gly
  5. Aeribacillus pallidus tRNA-Gly
  6. Aeribacillus sp. FSL K6-1121 tRNA-Gly
  7. Aeribacillus sp. FSL K6-1305 tRNA-Gly
  8. Aeribacillus sp. FSL k6-2211 tRNA-Gly
  9. Aeribacillus sp. FSL K6-2833 tRNA-Gly
  10. Aeribacillus sp. FSL K6-2848 tRNA-Gly
  11. Aeribacillus sp. FSL K6-3256 tRNA-Gly
  12. Aeribacillus sp. FSL K6-8210 tRNA-Gly
  13. Aeribacillus sp. FSL K6-8394 tRNA-Gly
  14. Aeribacillus sp. FSL M8-0235 tRNA-Gly
  15. Aeribacillus sp. FSL M8-0254 tRNA-Gly
  16. Aeribacillus sp. FSL W8-0870 tRNA-Gly
  17. Aeribacillus sp. SP014 tRNA-Gly
  18. Aliibacillus thermotolerans tRNA-Gly
  19. Aliicoccus persicus tRNA-Gly
  20. Alkalicoccobacillus gibsonii tRNA-Gly
  21. Alkalihalobacillus alcalophilus tRNA-Gly
  22. Alkalihalobacillus phoenicis tRNA-Gly
  23. Alkalihalobacillus sp. AL-G tRNA-Gly
  24. Alkalihalobacillus sp. MEB130 tRNA-Gly
  25. Alkalihalobacillus sp. SIMBA_132 tRNA-Gly
  26. Allobacillus halotolerans tRNA-Gly
  27. Allobacillus sp. GCM10007489 tRNA-Gly
  28. Allobacillus sp. GCM10007490 tRNA-Gly
  29. Allobacillus sp. GCM10007491 tRNA-Gly
  30. Allobacillus sp. SKP2-8 tRNA-Gly
  31. Allobacillus salarius tRNA-Gly
  32. Allobacillus saliphilus tRNA-Gly
  33. Alteribacillus sp. JSM 102045 tRNA-Gly
  34. Amphibacillus xylanus NBRC 15112 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  35. Anaerobacillus sp. ABA4_114 tRNA-Gly
  36. Anaerobacillus sp. ABD4_527 tRNA-Gly
  37. Anaerobacillus sp. ABR4_044 tRNA-Gly
  38. Anaerobacillus sp. ABR4_318 tRNA-Gly
  39. Anaerobacillus sp. ABR4_321 tRNA-Gly
  40. Aneurinibacillus aneurinilyticus tRNA-Gly
  41. Aquibacillus albus tRNA-Gly
  42. Aquibacillus halophilus tRNA-Gly
  43. Aquibacillus koreensis tRNA-Gly
  44. Aquibacillus salsiterrae tRNA-Gly
  45. Bacillaceae bacterium C204 tRNA-Gly
  46. Bacillaceae bacterium (coal metagenome) tRNA-Gly
  47. Bacillaceae bacterium HSR45 tRNA-Gly
  48. Mangrovibacillus cuniculi tRNA-Gly
  49. Bacillaceae bacterium S4-13-56 tRNA-Gly
  50. Bacillaceae bacterium S4-13-58 tRNA-Gly
  51. Bacillaceae bacterium SAOS 7 tRNA-Gly
  52. Bacillaceae bacterium SAS-127 tRNA-Gly
  53. Radiobacillus deserti tRNA-Gly
  54. Caryophanales bacterium tRNA-Gly
  55. Bacilli bacterium tRNA-Gly
  56. Bacilli bacterium VT-13-104 tRNA-Gly
  57. Bacillota bacterium Lsc_1132 tRNA-Gly
  58. Bacillota bacterium tRNA-Gly
  59. Bacillus aerius tRNA-Gly
  60. Bacillus aerophilus tRNA-Gly
  61. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Gly
  62. Bacillus altitudinis A23-8 tRNA-Gly
  63. Bacillus altitudinis C101 tRNA-Gly
  64. Bacillus altitudinis MN12 tRNA-Gly
  65. Bacillus altitudinis S70-5-12 tRNA-Gly
  66. Bacillus altitudinis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  67. Bacillus amyloliquefaciens CC178 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  68. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  69. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Gly
  70. Bacillus amyloliquefaciens IT-45 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  71. Bacillus amyloliquefaciens KHG19 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  72. Bacillus amyloliquefaciens LFB112 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  73. Bacillus amyloliquefaciens tRNA-Gly
  74. Bacillus amyloliquefaciens UASWS BA1 tRNA-Gly
  75. Bacillus amyloliquefaciens UMAF6614 tRNA-Gly
  76. Bacillus amyloliquefaciens UMAF6639 tRNA-Gly
  77. Bacillus anthracis tRNA-Gly
  78. Bacillus australimaris tRNA-Gly
  79. Bacillus ayatagriensis tRNA-Gly
  80. Schinkia azotoformans MEV2011 tRNA-Gly
  81. Bacillus cabrialesii subsp. cabrialesii tRNA-Gly
  82. Bacillus cabrialesii subsp. tritici tRNA-Gly
  83. Bacillus cabrialesii tRNA-Gly
  84. Bacillus carboniphilus tRNA-Gly
  85. Bacillus altitudinis tRNA-Gly
  86. Bacillus cereus tRNA-Gly
  87. Bacillus changyiensis tRNA-Gly
  88. Bacillus chungangensis tRNA-Gly
  89. Niallia circulans tRNA-Gly
  90. Bacillus coahuilensis m2-6 tRNA-Gly
  91. Bacillus coahuilensis p1.1.43 tRNA-Gly
  92. Bacillus coahuilensis tRNA-Gly
  93. Bacillus crepusculi tRNA-Gly
  94. Cytobacillus dafuensis tRNA-Gly
  95. Cytobacillus depressus tRNA-Gly
  96. [Bacillus] enclensis tRNA-Gly
  97. Priestia endophytica DSM 13796 tRNA_Gly_GCC
  98. Priestia endophytica tRNA-Gly
  99. Niallia endozanthoxylica tRNA-Gly
  100. Bacillus fengqiuensis tRNA-Gly
  101. Priestia filamentosa tRNA-Gly
  102. Bacillus glycinifermentans tRNA-Gly
  103. Bacillus haikouensis tRNA-Gly
  104. Bacillus halotolerans tRNA-Gly
  105. Bacillus haynesii tRNA-Gly
  106. Bacillus inaquosorum tRNA-Gly(gcc)
  107. Metabacillus indicus LMG 22858 tRNA-Gly
  108. Bacillus spizizenii tRNA-Gly
  109. Bacillus jepli tRNA-Gly
  110. Priestia koreensis tRNA-Gly
  111. Halalkalibacter krulwichiae tRNA-Gly
  112. Robertmurraya kyonggiensis tRNA-Gly
  113. Lederbergia lenta tRNA-Gly(gcc)
  114. Bacillus licheniformis CG-B52 tRNA-Gly
  115. Bacillus [licheniformis] CMCC 63516 tRNA-Gly
  116. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  117. Bacillus licheniformis LMG 17339 tRNA-Gly
  118. Bacillus licheniformis tRNA-Gly
  119. Bacillus licheniformis WX-02 tRNA-Gly
  120. Bacillus litorisediminis tRNA
  121. Bacillus lumedeiriae tRNA-Gly
  122. Rossellomorea marisflavi tRNA-Gly
  123. Priestia megaterium tRNA-Gly
  124. Neobacillus mesonae tRNA-Gly
  125. Bacillus mesophilum tRNA-Gly
  126. Bacillus mesophilus tRNA-Gly
  127. Bacillus methanolicus PB1 tRNA-Gly
  128. Bacillus methanolicus tRNA-Gly
  129. Bacillus mexicanus tRNA-Gly
  130. Bacillus mojavensis RO-H-1 = KCTC 3706 tRNA-Gly
  131. Bacillus mojavensis tRNA-Gly
  132. Alkalicoccobacillus murimartini tRNA-Gly
  133. Bacillus nakamurai tRNA-Gly
  134. Halalkalibacter nanhaiisediminis tRNA-Gly
  135. Niallia nealsonii AAU1 tRNA-Gly
  136. Neobacillus notoginsengisoli tRNA-Gly
  137. Bacillus obstructivus tRNA-Gly
  138. Halalkalibacter okhensis tRNA-Gly
  139. Halalkalibacterium halodurans tRNA-Gly
  140. Bacillus oleivorans tRNA-Gly
  141. Bacillus paralicheniformis ATCC 9945a tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  142. Bacillus paralicheniformis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  143. Bacillus paranthracis tRNA-Gly
  144. Alkalihalobacillus pseudalcaliphilus tRNA-Gly
  145. Bacillus pumilus ATCC 7061 tRNA-Gly
  146. Bacillus pumilus SAFR-032 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  147. Bacillus pumilus tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  148. Bacillus rugosus tRNA-Gly
  149. Bacillus safensis FO-36b tRNA-Gly
  150. Bacillus safensis subsp. osmophilus tRNA-Gly
  151. Bacillus safensis subsp. safensis tRNA-Gly(gcc)
  152. Bacillus safensis tRNA-Gly(gcc)
  153. Bacillus salitolerans tRNA-Gly
  154. Bacillus seohaeanensis tRNA-Gly
  155. Bacillus shivajii tRNA-Gly
  156. Bacillus siamensis tRNA-Gly
  157. Bacillus solimangrovi tRNA-Gly
  158. Bacillus songklensis tRNA-Gly
  159. Bacillus sonorensis L12 tRNA-Gly
  160. Bacillus sonorensis tRNA-Gly
  161. Bacillus sp. 005/A4HT-01/001 tRNA-Gly
  162. Bacillus sp. 0102A tRNA-Gly
  163. Bacillus sp. 0209A tRNA-Gly
  164. Bacillus sp. 0909A tRNA-Gly
  165. Bacillus sp. 1006-3 tRNA-Gly
  166. Bacillus sp. 1021 tRNA-Gly
  167. Bacillus sp. 153480031-1 tRNA-Gly
  168. Bacillus sp. 153480037-1 tRNA-Gly
  169. Bacillus sp. 1735sda2 tRNA-Gly
  170. Bacillus sp. 179-C3.3 HS tRNA-Gly
  171. Bacillus sp. BSDF18-5 Bacillus sp. 18-5 tRNA-Gly
  172. Bacillus sp. 1s-1 tRNA-Gly
  173. Bacillus sp. 2211 tRNA-Gly
  174. Bacillus sp. 22190 tRNA-Gly
  175. Bacillus sp. 22266 tRNA-Gly
  176. Bacillus sp. 22293 tRNA-Gly
  177. Bacillus sp. 22446 tRNA-Gly
  178. Bacillus sp. 22483 tRNA-Gly
  179. Bacillus sp. 275 tRNA-Gly
  180. Bacillus sp. 2CMS4F tRNA-Gly
  181. Robertmurraya mangrovi Bacillus sp. 31A1R tRNA-Gly
  182. Bacillus sp. 31 tRNA-Gly
  183. Bacillus sp. 348 tRNA-Gly
  184. Bacillus sp. 349Y tRNA-Gly
  185. Bacillus sp. 3A_MP1 tRNA-Gly
  186. Bacillus sp. 3a tRNA-Gly
  187. Bacillus sp. 4A_MP2 tRNA-Gly
  188. Bacillus sp. 4A_MP3 tRNA-Gly
  189. Bacillus sp. 5001 tRNA-Gly
  190. Bacillus sp. 5B6 tRNA-Gly
  191. Bacillus sp. 7504-2 tRNA-Gly
  192. Bacillus sp. 7586-K tRNA-Gly
  193. Bacillus sp. 7788 tRNA-Gly
  194. Bacillus sp. 7884-1 tRNA-Gly
  195. Bacillus sp. 7D3 tRNA-Gly
  196. Bacillus sp. 8A6 tRNA-Gly
  197. Bacillus sp. 9J tRNA-Gly
  198. Bacillus sp. A015 tRNA-Gly
  199. Bacillus sp. A053 tRNA-Gly
  200. Bacillus sp. A1 tRNA-Gly
  201. Bacillus sp. A31 tRNA-Gly
  202. Bacillus sp. AAVF1 tRNA-Gly
  203. Bacillus sp. ABA4_010 tRNA-Gly
  204. Bacillus sp. AF12 tRNA-Gly
  205. Bacillus sp. AF23 tRNA-Gly
  206. Bacillus sp. AF42 tRNA-Gly
  207. Bacillus sp. AFS015802 tRNA-Gly
  208. Bacillus sp. AFS037270 tRNA-Gly
  209. Bacillus sp. AFS040349 tRNA-Gly
  210. Bacillus sp. AFS073361 tRNA-Gly
  211. Bacillus sp. AFS076308 tRNA-Gly
  212. Bacillus sp. AG1 tRNA-Gly
  213. Bacillus sp. AK031 tRNA-Gly
  214. Bacillus sp. AK124 tRNA-Gly
  215. Bacillus sp. AK128 tRNA-Gly
  216. Bacillus sp. AK130 tRNA-Gly
  217. Bacillus sp. AK25 tRNA-Gly
  218. Bacillus sp. alh8 tRNA-Gly
  219. Bacillus sp. AM1(2019) tRNA-Gly
  220. Bacillus sp. AM 13(2015) tRNA-Gly
  221. Bacillus sp. AN2 tRNA-Gly
  222. Bacillus sp. AnS8 tRNA-Gly
  223. Bacillus sp. ANT_WA51 tRNA-Gly
  224. Bacillus sp. APMAM tRNA-Gly
  225. Bacillus sp. AR11 tRNA-Gly
  226. Bacillus sp. ATD tRNA-Gly
  227. Bacillus siamensis Bacillus sp. B01(2024) tRNA-Gly
  228. Bacillus sp. B088 tRNA-Gly
  229. Bacillus sp. B1(2022) tRNA-Gly
  230. Bacillus sp. B18(2022) tRNA-Gly
  231. Bacillus sp. B19-2 tRNA-Gly
  232. Bacillus sp. B1-b2 tRNA-Gly
  233. Bacillus sp. B2(2022) tRNA-Gly
  234. Bacillus sp. B28 tRNA-Gly
  235. Bacillus sp. B38 tRNA-Gly
  236. Bacillus sp. B6(2022) tRNA-Gly
  237. Bacillus sp. B8(2022) tRNA-Gly
  238. Bacillus sp. BACIII tRNA-Gly
  239. Bacillus sp. BAC tRNA-Gly
  240. Bacillus sp. BC1-43 tRNA-Gly
  241. Bacillus sp. BD48 tRNA-Gly
  242. Bacillus sp. BGMRC 2118 tRNA-Gly
  243. Bacillus sp. BH072 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  244. Bacillus sp. BHET2 tRNA-Gly
  245. Bacillus sp. B-jedd tRNA-Gly
  246. Bacillus sp. BMG-18 tRNA-Gly
  247. Bacillus sp. B.PNR1 tRNA-Gly
  248. Bacillus sp. B.PNR2 tRNA-Gly
  249. Bacillus sp. BR_10 tRNA-Gly
  250. Bacillus sp. BS1807G30 tRNA-Gly
  251. Bacillus sp. BS3(2021) tRNA-Gly
  252. Bacillus sp. BT1B_CT2 tRNA-Gly
  253. Cytobacillus sp. Bva_UNVM-123 Bacillus sp. Bva_UNVM-123 tRNA-Gly
  254. Bacillus sp. Bwzl_19 tRNA-Gly
  255. Bacillus sp. C10(2022) tRNA-Gly
  256. Bacillus sp. C11(2022) tRNA-Gly
  257. Bacillus sp. C1(2022) tRNA-Gly
  258. Bacillus sp. C15(2022) tRNA-Gly
  259. Bacillus sp. C15 tRNA-Gly
  260. Bacillus sp. C21 tRNA-Gly
  261. Bacillus sp. C2(2022) tRNA-Gly
  262. Bacillus sp. C28GYM-DRY-1 tRNA-Gly
  263. Bacillus sp. C3(2022) tRNA-Gly
  264. Bacillus sp. C37plca tRNA-Gly
  265. Bacillus sp. C5(2022) tRNA-Gly
  266. Bacillus sp. CCNWLCWHY013 tRNA-Gly
  267. Bacillus sp. CGMCC 1.16607 tRNA-Gly
  268. Bacillus sp. CH30_1T tRNA-Gly
  269. Bacillus sp. CHD6a tRNA-Gly
  270. Bacillus sp. ChL18 tRNA-Gly
  271. Bacillus sp. CIS52 tRNA-Gly
  272. Bacillus sp. CJ1 tRNA-Gly
  273. Bacillus sp. CJCL2 tRNA-Gly
  274. Bacillus sp. cl95 tRNA_Gly_GCC
  275. Bacillus sp. CMAA 1185 tRNA-Gly
  276. Bacillus sp. CMF21 tRNA-Gly
  277. Bacillus sp. CN2 tRNA-Gly
  278. Bacillus sp. CPSM8 tRNA-Gly
  279. Bacillus haimaensis Bacillus sp. CSS-39 tRNA-Gly
  280. Bacillus aerolatus tRNA-Gly
  281. Bacillus sp. D12 tRNA-Gly
  282. Bacillus sp. D7-8 tRNA-Gly
  283. Bacillus sp. DFI.2.34 tRNA-Gly
  284. Bacillus sp. DJP31 tRNA-Gly
  285. Bacillus sp. DM2 tRNA-Gly
  286. Bacillus sp. DNRA2 tRNA-Gly
  287. Bacillus sp. DR8(2025) tRNA-Gly
  288. Metabacillus sediminilitoris tRNA-Gly
  289. Bacillus sp. DSM 27956 tRNA-Gly
  290. Bacillus sp. DTU_2020_1000418_1_SI_GHA_SEK_038 tRNA-Gly
  291. Bacillus sp. EB106-04-04-XG123 tRNA-Gly
  292. Bacillus sp. EB106-08-02-XG196 tRNA-Gly
  293. Bacillus sp. EB106-09-04-XG55 tRNA-Gly
  294. Bacillus sp. EKM208B tRNA-Gly
  295. Bacillus sp. EKM213B tRNA-Gly
  296. Bacillus sp. EKM417B tRNA-Gly
  297. Bacillus sp. EKM420B tRNA-Gly
  298. Bacillus sp. es.034 tRNA-Gly
  299. Bacillus sp. ESY73 tRNA-Gly
  300. Bacillus sp. ESY92 tRNA-Gly
  301. Bacillus sp. EU52 tRNA-Gly
  302. Bacillus sp. EU55 tRNA-Gly
  303. Bacillus sp. EU62 tRNA-Gly
  304. Bacillus sp. EU63 tRNA-Gly
  305. Bacillus sp. F1-12(2026) tRNA-Gly
  306. Bacillus sp. F19 tRNA-Gly
  307. Bacillus sp. F2HM tRNA-Gly
  308. Bacillus sp. FCW2 tRNA-Gly
  309. Bacillus sp. FJAT-14266 tRNA-Gly
  310. Bacillus sp. FJAT-18017 tRNA-Gly
  311. Bacillus sp. FJAT-21945 tRNA-Gly
  312. Bacillus sp. FJAT-21955 tRNA-Gly
  313. Bacillus sp. FJAT-27225 tRNA-Gly
  314. Bacillus sp. FJAT-27231 tRNA-Gly
  315. Bacillus sp. FJAT-27445 tRNA-Gly
  316. Bacillus sp. FJAT-27916 tRNA-Gly
  317. Bacillus sp. FJAT-27986 tRNA-Gly
  318. Bacillus sp. FJAT-29790 tRNA-Gly
  319. Bacillus sp. FJAT-29953 tRNA-Gly
  320. Bacillus sp. FJAT-42376 tRNA-Gly
  321. Lederbergia citrea tRNA-Gly
  322. Bacillus sp. FJAT-49711 tRNA-Gly
  323. Lederbergia citrea tRNA-Gly
  324. Bacillus sp. FJAT-49736 tRNA-Gly
  325. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Gly
  326. Bacillus sp. FJAT-53060 tRNA-Gly
  327. Bacillus sp. FMQ74 tRNA-Gly
  328. Bacillus sp. FSL E2-0174 tRNA-Gly
  329. Bacillus sp. FSL H7-0578 tRNA-Gly
  330. Bacillus sp. FSL H8-0512 tRNA-Gly
  331. Bacillus sp. FSL H8-0515 tRNA-Gly
  332. Bacillus sp. FSL H8-0516 tRNA-Gly
  333. Bacillus sp. FSL H8-0547 tRNA-Gly
  334. Bacillus sp. FSL K6-0036 tRNA-Gly
  335. Bacillus sp. FSL K6-0046 tRNA-Gly
  336. Bacillus sp. FSL K6-0138 tRNA-Gly
  337. Bacillus sp. FSL K6-0250 tRNA-Gly
  338. Bacillus sp. FSL K6-0255 tRNA-Gly
  339. Bacillus sp. FSL K6-0764 tRNA-Gly
  340. Bacillus sp. FSL K6-0923 tRNA-Gly
  341. Bacillus sp. FSL K6-0947 tRNA-Gly
  342. Bacillus sp. FSL K6-0972 tRNA-Gly
  343. Bacillus sp. FSL K6-0993 tRNA-Gly
  344. Bacillus sp. FSL K6-0994 tRNA-Gly
  345. Bacillus sp. FSL K6-0998 tRNA-Gly
  346. Bacillus sp. FSL K6-1000 tRNA-Gly
  347. Bacillus sp. FSL K6-1003 tRNA-Gly
  348. Bacillus sp. FSL K6-1005 tRNA-Gly
  349. Bacillus sp. FSL K6-1006 tRNA-Gly
  350. Bacillus sp. FSL K6-1012 tRNA-Gly
  351. Bacillus sp. FSL K6-1033 tRNA-Gly
  352. Bacillus sp. FSL K6-1106 tRNA-Gly
  353. Bacillus sp. FSL K6-1109 tRNA-Gly
  354. Bacillus sp. FSL K6-1145 tRNA-Gly
  355. Bacillus sp. FSL K6-1234 tRNA-Gly
  356. Bacillus sp. FSL K6-1284 tRNA-Gly
  357. Bacillus sp. FSL K6-1336 tRNA-Gly
  358. Bacillus sp. FSL K6-1366 tRNA-Gly
  359. Bacillus sp. FSL K6-1560 tRNA-Gly
  360. Bacillus sp. FSL K6-2431 tRNA-Gly
  361. Bacillus sp. FSL K6-2819 tRNA-Gly
  362. Bacillus sp. FSL K6-2837 tRNA-Gly
  363. Bacillus sp. FSL K6-2839 tRNA-Gly
  364. Bacillus sp. FSL K6-2841 tRNA-Gly
  365. Bacillus sp. FSL K6-2860 tRNA-Gly
  366. Bacillus sp. FSL K6-2861 tRNA-Gly
  367. Bacillus sp. FSL K6-2865 tRNA-Gly
  368. Bacillus sp. FSL K6-2869 tRNA-Gly
  369. Bacillus sp. FSL K6-2971 tRNA-Gly
  370. Bacillus sp. FSL K6-3149 tRNA-Gly
  371. Bacillus sp. FSL K6-3154 tRNA-Gly
  372. Bacillus sp. FSL K6-3176 tRNA-Gly
  373. Bacillus sp. FSL K6-3200 tRNA-Gly
  374. Bacillus sp. FSL K6-3221 tRNA-Gly
  375. Bacillus sp. FSL K6-3312 tRNA-Gly
  376. Bacillus sp. FSL K6-3458 tRNA-Gly
  377. Bacillus sp. FSL K6-3459 tRNA-Gly
  378. Bacillus sp. FSL K6-3846 tRNA-Gly
  379. Bacillus sp. FSL K6-4563 tRNA-Gly
  380. Bacillus sp. FSL K6-5915 tRNA-Gly
  381. Bacillus sp. FSL K6-6540 tRNA-Gly
  382. Bacillus sp. FSL K6-8391 tRNA-Gly
  383. Bacillus sp. FSL L8-0167 tRNA-Gly
  384. Bacillus sp. FSL L8-0173 tRNA-Gly
  385. Bacillus sp. FSL L8-0186 tRNA-Gly
  386. Bacillus sp. FSL L8-0193 tRNA-Gly
  387. Bacillus sp. FSL L8-0215 tRNA-Gly
  388. Bacillus sp. FSL L8-0222 tRNA-Gly
  389. Bacillus sp. FSL L8-0358 tRNA-Gly
  390. Bacillus sp. FSL L8-0528 tRNA-Gly
  391. Bacillus sp. FSL L8-0533 tRNA-Gly
  392. Bacillus sp. FSL L8-0654 tRNA-Gly
  393. Bacillus sp. FSL L8-0661 tRNA-Gly
  394. Bacillus sp. FSL M7-0003 tRNA-Gly
  395. Bacillus sp. FSL M7-0307 tRNA-Gly
  396. Bacillus sp. FSL M7-0417 tRNA-Gly
  397. Bacillus sp. FSL M7-0558 tRNA-Gly
  398. Bacillus sp. FSL M7-0791 tRNA-Gly
  399. Bacillus sp. FSL M7-1004 tRNA-Gly
  400. Bacillus sp. FSL M8-0025 tRNA-Gly
  401. Bacillus sp. FSL M8-0049 tRNA-Gly
  402. Bacillus sp. FSL M8-0052 tRNA-Gly
  403. Bacillus sp. FSL M8-0054 tRNA-Gly
  404. Bacillus sp. FSL M8-0071 tRNA-Gly
  405. Bacillus sp. FSL M8-0077 tRNA-Gly
  406. Bacillus sp. FSL M8-0133 tRNA-Gly
  407. Bacillus sp. FSL M8-0166 tRNA-Gly
  408. Bacillus sp. FSL M8-0168 tRNA-Gly
  409. Bacillus sp. FSL M8-0256 tRNA-Gly
  410. Bacillus sp. FSL M8-0266 tRNA-Gly
  411. Bacillus sp. FSL M8-0277 tRNA-Gly
  412. Bacillus sp. FSL M8-0315 tRNA-Gly
  413. Bacillus sp. FSL M8-0326 tRNA-Gly
  414. Bacillus sp. FSL M8-0350 tRNA-Gly
  415. Bacillus sp. FSL P2-0026 tRNA-Gly
  416. Bacillus sp. FSL P2-0069 tRNA-Gly
  417. Bacillus sp. FSL P2-0092 tRNA-Gly
  418. Bacillus sp. FSL P4-0248 tRNA-Gly
  419. Bacillus sp. FSL P4-0290 tRNA-Gly
  420. Bacillus sp. FSL P4-0322 tRNA-Gly
  421. Bacillus sp. FSL P4-0334 tRNA-Gly
  422. Bacillus sp. FSL R5-0286 tRNA-Gly
  423. Bacillus sp. FSL R5-0293 tRNA-Gly
  424. Bacillus sp. FSL R5-0397 tRNA-Gly
  425. Bacillus sp. FSL R5-0416 tRNA-Gly
  426. Bacillus sp. FSL R5-0418 tRNA-Gly
  427. Bacillus sp. FSL R5-0422 tRNA-Gly
  428. Bacillus sp. FSL R5-0431 tRNA-Gly
  429. Bacillus sp. FSL R5-0432 tRNA-Gly
  430. Bacillus sp. FSL R5-0434 tRNA-Gly
  431. Bacillus sp. FSL R5-0439 tRNA-Gly
  432. Bacillus sp. FSL R5-0443 tRNA-Gly
  433. Bacillus sp. FSL R5-0447 tRNA-Gly
  434. Bacillus sp. FSL R5-0512 tRNA-Gly
  435. Bacillus sp. FSL R5-0523 tRNA-Gly
  436. Bacillus sp. FSL R5-0560 tRNA-Gly
  437. Bacillus sp. FSL R5-0576 tRNA-Gly
  438. Bacillus sp. FSL R5-0586 tRNA-Gly
  439. Bacillus sp. FSL R5-0593 tRNA-Gly
  440. Bacillus sp. FSL R5-0603 tRNA-Gly
  441. Bacillus sp. FSL R5-0654 tRNA-Gly
  442. Bacillus sp. FSL R5-0659 tRNA-Gly
  443. Bacillus sp. FSL R5-0712 tRNA-Gly
  444. Bacillus sp. FSL R5-0820 tRNA-Gly
  445. Bacillus sp. FSL R7-0166 tRNA-Gly
  446. Bacillus sp. FSL R7-0229 tRNA-Gly
  447. Bacillus sp. FSL R7-0646 tRNA-Gly
  448. Bacillus sp. FSL R7-0651 tRNA-Gly
  449. Bacillus sp. FSL R7-0672 tRNA-Gly
  450. Bacillus sp. FSL R7-0675 tRNA-Gly
  451. Bacillus sp. FSL R7-0685 tRNA-Gly
  452. Bacillus sp. FSL R7-0718 tRNA-Gly
  453. Bacillus sp. FSL W7-1034 tRNA-Gly
  454. Bacillus sp. FSL W7-1085 tRNA-Gly
  455. Bacillus sp. FSL W7-1092 tRNA-Gly
  456. Bacillus sp. FSL W7-1336 tRNA-Gly
  457. Bacillus sp. FSL W7-1346 tRNA-Gly
  458. Bacillus sp. FSL W7-1354 tRNA-Gly
  459. Bacillus sp. FSL W7-1582 tRNA-Gly
  460. Bacillus sp. FSL W8-0006 tRNA-Gly
  461. Bacillus sp. FSL W8-0183 tRNA-Gly
  462. Bacillus sp. FSL W8-0445 tRNA-Gly
  463. Bacillus sp. FSL W8-0502 tRNA-Gly
  464. Bacillus sp. FSL W8-0629 tRNA-Gly
  465. Bacillus sp. FSL W8-0645 tRNA-Gly
  466. Bacillus sp. FSL W8-0672 tRNA-Gly
  467. Bacillus sp. FSL W8-0812 tRNA-Gly
  468. Bacillus sp. FSL W8-0848 tRNA-Gly
  469. Bacillus sp. FSL W8-0920 tRNA-Gly
  470. Bacillus sp. FSL W8-0940 tRNA-Gly
  471. Bacillus sp. FSL W8-1141 tRNA-Gly
  472. Bacillus sp. FSL W8-1143 tRNA-Gly
  473. Bacillus sp. FSL W8-1202 tRNA-Gly
  474. Bacillus sp. FW1 tRNA-Gly
  475. Bacillus sp. G1(2015b) (2015b) tRNA-Gly
  476. Bacillus sp. G16 tRNA-Gly
  477. Bacillus sp. G402 tRNA-Gly
  478. Bacillus sp. GBSC66 tRNA-Gly
  479. Bacillus sp. GBSW19 tRNA-Gly
  480. Bacillus sp. GBSW2 tRNA-Gly
  481. Bacillus sp. Gen2 tRNA-Gly
  482. Bacillus sp. Gen3 tRNA-Gly
  483. Bacillus sp. GG161 tRNA-Gly
  484. Bacillus sp. GM1 tRNA-Gly
  485. Bacillus sp. GM2 tRNA-Gly
  486. Bacillus sp. GZB tRNA-Gly
  487. Bacillus sp. H15-1 tRNA-Gly
  488. Bacillus sp. H1F1 tRNA-Gly
  489. Bacillus sp. H2FL2 tRNA-Gly
  490. Bacillus sp. HB022 tRNA-Gly
  491. Exobacillus caeni tRNA-Gly
  492. Litchfieldia suaedae tRNA-Gly
  493. Bacillus sp. Hm123 tRNA-Gly
  494. Bacillus salinus tRNA-Gly
  495. Bacillus sp. HMG tRNA-Gly
  496. Bacillus sp. HMSC76G11 tRNA-Gly
  497. Bacillus sp. HN03 tRNA-Gly
  498. Bacillus sp. HNA3 tRNA-Gly
  499. Bacillus sp. HNG tRNA-Gly
  500. Bacillus sp. HSf4 tRNA-Gly
  501. Bacillus sp. I-2 tRNA-Gly
  502. Metabacillus arenae tRNA-Gly
  503. Bacillus sp. ICE1 tRNA-Gly
  504. Bacillus sp. IG2 tRNA-Gly
  505. Bacillus sp. IG6 tRNA-Gly
  506. Bacillus sp. IITD106 tRNA-Gly
  507. Bacillus sp. (in: firmicutes) tRNA-Gly
  508. Bacillus sp. IS1 tRNA-Gly
  509. Bacillus sp. ISL-18 tRNA-Gly
  510. Bacillus sp. ISL-26 tRNA-Gly
  511. Bacillus sp. iso_77 tRNA-Gly
  512. Bacillus sp. IT-13CA1 tRNA-Gly
  513. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Gly
  514. Bacillus spizizenii str. W23 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  515. Bacillus spizizenii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  516. Bacillus spizizenii TU-B-10 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  517. Bacillus sp. J14 tRNA-Gly
  518. Bacillus sp. J41TS8 tRNA-Gly
  519. Bacillus sp. J5TS4 tRNA-Gly
  520. Bacillus sp. Je.9.29.b tRNA-Gly
  521. Bacillus sp. JHAA tRNA-Gly
  522. Sutcliffiella rhizosphaerae tRNA-Gly
  523. Bacillus sp. JJ1474 tRNA-Gly
  524. Bacillus sp. JJ1521 tRNA-Gly
  525. Bacillus sp. JJ1532 tRNA-Gly
  526. Bacillus sp. JJ1533 tRNA-Gly
  527. Bacillus sp. JJ1562 tRNA-Gly
  528. Bacillus sp. JJ1566 tRNA-Gly
  529. Bacillus sp. JJ1764 tRNA-Gly
  530. Bacillus sp. JJ1773 tRNA-Gly
  531. Bacillus sp. JJ353 tRNA-Gly
  532. Bacillus sp. JJ675 tRNA-Gly
  533. Bacillus sp. JK106 tRNA-Gly
  534. Bacillus sp. JK127 tRNA-Gly
  535. Bacillus sp. JK62 tRNA-Gly
  536. Bacillus sp. JK74 tRNA-Gly
  537. Bacillus sp. JNUCC-21 tRNA-Gly
  538. Bacillus sp. JNUCC-22 tRNA-Gly
  539. Bacillus sp. JNUCC-24 tRNA-Gly
  540. Bacillus sp. JRC01 tRNA-Gly
  541. Bacillus sp. JS tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  542. Bacillus sp. JUb11 tRNA-Gly
  543. Bacillus sp. jun1 tRNA-Gly
  544. Bacillus sp. jun7 tRNA-Gly
  545. Bacillus sp. JZ105 tRNA-Gly
  546. Bacillus sp. JZ109 tRNA-Gly
  547. Bacillus sp. JZ142 tRNA-Gly
  548. Bacillus sp. JZ33 tRNA-Gly
  549. Bacillus sp. JZ34 tRNA-Gly
  550. Bacillus sp. JZ35 tRNA-Gly
  551. Bacillus sp. JZ39 tRNA-Gly
  552. Bacillus sp. JZ71 tRNA-Gly
  553. Bacillus sp. JZ76 tRNA-Gly
  554. Bacillus sp. JZ78 tRNA-Gly
  555. Bacillus sp. JZ8 tRNA-Gly
  556. Bacillus sp. K7 tRNA-Gly
  557. Bacillus sp. KBS0812 tRNA-Gly
  558. Bacillus sp. KeR2 tRNA-Gly
  559. Bacillus sp. KH172YL63 tRNA-Gly
  560. Bacillus sp. KICET-1 tRNA-Gly
  561. Bacillus sp. KICET-3 tRNA-Gly
  562. Bacillus sp. KS1 tRNA-Gly
  563. Bacillus sp. L_1B0_12 tRNA-Gly
  564. Bacillus sp. L381 tRNA-Gly
  565. Bacillus sp. LB7 tRNA-Gly
  566. Bacillus sp. LBG-1-113 tRNA-Gly
  567. Bacillus sp. Leaf406 tRNA-Gly
  568. Bacillus sp. Leaf49 tRNA-Gly
  569. Neobacillus massiliamazoniensis tRNA-Gly
  570. Bacillus sp. LJBS06 tRNA-Gly
  571. Bacillus sp. LJBS17 tRNA-Gly
  572. Bacillus sp. LJBV19 tRNA-Gly
  573. Bacillus sp. LK10 tRNA-Gly
  574. Bacillus sp. LK7 tRNA-Gly
  575. Bacillus sp. LL01 tRNA-Gly
  576. Bacillus sp. LLTC93 tRNA-Gly
  577. Bacillus sp. LM 4-2 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  578. Bacillus sp. LMB3902 tRNA-Gly
  579. Bacillus sp. LMT tRNA-Gly
  580. Bacillus sp. LNXM10 tRNA-Gly
  581. Bacillus sp. LNXM12-1 tRNA-Gly
  582. Bacillus sp. LNXM12-2 tRNA-Gly
  583. Bacillus sp. LNXM65 tRNA-Gly
  584. Bacillus sp. LR--39 tRNA-Gly
  585. Bacillus sp. LR_6 tRNA-Gly
  586. Bacillus sp. LUNF1 tRNA-Gly
  587. Bacillus sp. LYLB4 tRNA-Gly
  588. Bacillus velezensis tRNA-Gly
  589. Bacillus sp. M 2-6 tRNA-Gly
  590. Alteribacter natronophilus Bacillus sp. M30 tRNA-Gly
  591. Bacillus sp. MAG717A tRNA-Gly
  592. Bacillus sp. Man122 tRNA-Gly
  593. Bacillus sp. MBGLi79 tRNA-Gly
  594. Bacillus sp. MBGLi97 tRNA-Gly
  595. Bacillus sp. MD-5 tRNA-Gly
  596. Bacillus sp. MFK14 tRNA-Gly
  597. Bacillus sp. MFK6 tRNA-Gly
  598. Bacillus sp. MKU004 tRNA-Gly
  599. Bacillus sp. MM09(2025) tRNA-Gly
  600. Bacillus sp. MMG021 tRNA-Gly
  601. Bacillus sp. MRMR6 tRNA-Gly
  602. Bacillus sp. ms-22 tRNA-Gly
  603. Bacillus sp. MT(2024) tRNA-Gly
  604. Bacillus sp. MT tRNA-Gly
  605. Bacillus sp. MUM 116 tRNA-Gly
  606. Bacillus sp. MZGC1 tRNA-Gly
  607. Bacillus sp. N12A5 tRNA-Gly
  608. Bacillus sp. N13C7 tRNA-Gly
  609. Bacillus sp. N9 tRNA-Gly
  610. Bacillus sp. NEAU-16 tRNA-Gly
  611. Bacillus sp. NEAU-242-2 tRNA-Gly
  612. Bacillus sp. NIO_002 tRNA-Gly
  613. Bacillus sp. NMCC46 tRNA-Gly
  614. Bacillus sp. NMCC4 tRNA-Gly
  615. Bacillus sp. NMCN1 tRNA-Gly
  616. Bacillus sp. NMCN6 tRNA-Gly
  617. Bacillus sp. NMTD17 tRNA-Gly
  618. Bacillus sp. NPDC077027 tRNA-Gly
  619. Bacillus sp. NPDC093026 tRNA-Gly
  620. Bacillus sp. NSP9.1 tRNA-Gly
  621. Bacillus sp. NTK074B tRNA-Gly
  622. Bacillus sp. OAE578 tRNA-Gly
  623. Bacillus sp. OHL2 tRNA-Gly
  624. Bacillus spongiae tRNA-Gly
  625. Bacillus sp. OVS6 tRNA-Gly
  626. Bacillus sp. P003 tRNA-Gly
  627. Bacillus sp. PAMC22265 tRNA-Gly
  628. Bacillus sp. PAMC26543 tRNA-Gly
  629. Bacillus sp. PAMC26568 tRNA-Gly
  630. Bacillus sp. PAMC28571 tRNA-Gly
  631. Bacillus sp. PAMC28748 tRNA-Gly
  632. Bacillus sp. Pc3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  633. Bacillus sp. PCH94 tRNA-Gly
  634. Bacillus sp. PDNC022 tRNA-Gly
  635. Bacillus sp. PK3-037 tRNA-Gly
  636. Bacillus sp. PK3-045 tRNA-Gly
  637. Bacillus sp. PK3-056 tRNA-Gly
  638. Bacillus sp. PK3-130 tRNA-Gly
  639. Bacillus sp. PK3-136 tRNA-Gly
  640. Bacillus sp. PK3-137 tRNA-Gly
  641. Bacillus sp. PK3_68 tRNA-Gly
  642. Bacillus sp. PK5-004 tRNA-Gly
  643. Bacillus sp. PK5-006 tRNA-Gly
  644. Bacillus sp. PK5-009 tRNA-Gly
  645. Bacillus sp. PK5-025 tRNA-Gly
  646. Bacillus sp. PK5-030 tRNA-Gly
  647. Bacillus sp. PK5-050 tRNA-Gly
  648. Bacillus sp. PK6-013 tRNA-Gly
  649. Bacillus sp. PK6-025 tRNA-Gly
  650. Bacillus sp. PK6-026 tRNA-Gly
  651. Bacillus sp. PM43 tRNA-Gly
  652. Bacillus sp. PM8313 tRNA-Gly
  653. Litchfieldia stipae tRNA-Gly
  654. Bacillus sp. PS108 tRNA-Gly
  655. Bacillus sp. PS11(2022) tRNA-Gly
  656. Bacillus sp. PS18 tRNA-Gly
  657. Bacillus sp. PS194 tRNA-Gly
  658. Bacillus sp. PS196 tRNA-Gly
  659. Bacillus sp. PS20 tRNA-Gly
  660. Bacillus sp. PS210 tRNA-Gly
  661. Bacillus sp. PS217 tRNA-Gly
  662. Bacillus sp. PS237 tRNA-Gly
  663. Bacillus sp. PS65 tRNA-Gly
  664. Bacillus sp. PS68 tRNA-Gly
  665. Bacillus sp. PS93 tRNA-Gly
  666. Bacillus sp. PS95 tRNA-Gly
  667. Bacillus sp. PsM16 tRNA-Gly
  668. Bacillus sp. PVC-6B tRNA-Gly
  669. Bacillus sp. PW192 tRNA-Gly
  670. Bacillus sp. R45 tRNA-Gly
  671. Bacillus sp. RAR_M1_44 tRNA-Gly
  672. Bacillus sp. Rc4 tRNA-Gly
  673. Bacillus sp. REN16 tRNA-Gly
  674. Bacillus sp. RHF6 tRNA-Gly
  675. Bacillus sp. RHFS10 tRNA-Gly
  676. Bacillus sp. RK1064 tRNA-Gly
  677. Bacillus sp. RM3 tRNA-Gly
  678. Bacillus sp. RO1 tRNA-Gly
  679. Bacillus sp. RO2 tRNA-Gly
  680. Bacillus sp. RO3 tRNA-Gly
  681. Bacillus sp. Root920 tRNA-Gly
  682. Bacillus sp. RP12 tRNA-Gly
  683. Bacillus sp. RSS_NA_20 tRNA-Gly
  684. Bacillus sp. Ru63 tRNA-Gly
  685. Bacillus sp. S10C12M tRNA-Gly
  686. Bacillus sp. S17B2 tRNA-Gly
  687. Bacillus sp. S20C3 tRNA-Gly
  688. Bacillus sp. S2(2019) tRNA-Gly
  689. Bacillus sp. S3 tRNA-Gly
  690. Bacillus sp. SA1-12 tRNA-Gly
  691. Bacillus sp. SA116 tRNA-Gly
  692. Bacillus sp. SAJ1 tRNA-Gly
  693. Bacillus sp. SB49 tRNA-Gly
  694. Bacillus safensis tRNA-Gly
  695. Bacillus sp. SDLI1 tRNA-Gly
  696. Bacillus sp. seq1 tRNA-Gly
  697. Bacillus sp. SG20001 tRNA-Gly
  698. Bacillus sp. SG20032 tRNA-Gly
  699. Bacillus sp. SG20033 tRNA-Gly
  700. Bacillus sp. sid0103 tRNA-Gly
  701. Bacillus sp. SIMBA_005 tRNA-Gly
  702. Bacillus sp. SIMBA_006 tRNA-Gly
  703. Bacillus sp. SIMBA_008 tRNA-Gly
  704. Bacillus sp. SIMBA_026 tRNA-Gly
  705. Bacillus sp. SIMBA_031 tRNA-Gly
  706. Bacillus sp. SIMBA_033 tRNA-Gly
  707. Bacillus sp. SIMBA_154 tRNA-Gly
  708. Bacillus sp. SIMBA_161 tRNA-Gly
  709. Bacillus sp. SJS tRNA-Gly
  710. Bacillus sp. SKDU12 tRNA-Gly
  711. Bacillus salacetis tRNA-Gly
  712. Bacillus sp. SL112 tRNA-Gly
  713. Bacillus sp. SLBN-46 tRNA-Gly
  714. Bacillus sp. SLBN-57 tRNA-Gly
  715. Bacillus sp. SN1 tRNA-Gly
  716. Bacillus sp. S/N-304-OC-R1 tRNA-Gly
  717. Bacillus sp. SN32 tRNA-Gly
  718. Bacillus sp. SORGH_AS_0510 tRNA-Gly
  719. Bacillus sp. SPARC3 tRNA-Gly
  720. Paenibacillus sp. PL91 tRNA-Gly
  721. Bacillus paralicheniformis tRNA-Gly
  722. Bacillus sp. SW14 tRNA-Gly
  723. Bacillus sp. SYWMC9 tRNA-Gly
  724. Bacillus sp. SYZHC2 tRNA-Gly
  725. Bacillus sp. T17B1 tRNA-Gly
  726. Bacillus sp. T2-22 tRNA-Gly
  727. Bacillus sp. T2.9-1 tRNA-Gly(gcc)
  728. Bacillus sp. T9C1 tRNA-Gly
  729. Bacillus sp. TBS-096 tRNA-Gly
  730. Bacillus sp. TE9122W tRNA-Gly
  731. Bacillus sp. THAF10 tRNA-Gly
  732. Bacillus sp. TS-2 tRNA-Gly
  733. Bacillus sp. TSA-4 tRNA-Gly
  734. Bacillus sp. TV3D tRNA-Gly
  735. Bacillus sp. UMB0893 tRNA-Gly
  736. Bacillus sp. UMB0899 tRNA-Gly
  737. Bacillus sp. UNCCL13 tRNA_Gly_GCC
  738. Niallia alba tRNA-Gly
  739. Bacillus sp. URHA0034 tRNA-Gly
  740. Bacillus sp. V26 tRNA-Gly
  741. Bacillus sp. V2I10 tRNA-Gly
  742. Bacillus sp. V3 tRNA-Gly
  743. Bacillus sp. WC2502 tRNA-Gly
  744. Bacillus sp. WC2510 tRNA-Gly
  745. Bacillus sp. WMMC1349 tRNA-Gly
  746. Bacillus salipaludis tRNA-Gly
  747. Bacillus sp. WP8 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  748. Bacillus sp. WR11 tRNA-Gly
  749. Bacillus sp. WR12 tRNA-Gly
  750. Bacillus sp. WR13 tRNA-Gly
  751. Bacillus sp. X1(2014) (2014) tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  752. Bacillus sp. X2(2017) tRNA-Gly
  753. Bacillus sp. XT-2 tRNA-Gly
  754. Bacillus yapensis tRNA-Gly
  755. Bacillus sp. XZ-5 tRNA-Gly
  756. Bacillus sp. y1(2019) tRNA-Gly
  757. Bacillus sp. Y1 tRNA-Gly
  758. Bacillus sp. Y3 tRNA-Gly
  759. Bacillus sp. YAF8 tRNA-Gly
  760. Bacillus sp. YBsi01 tRNA-Gly
  761. Bacillus sp. YBWC18 tRNA-Gly
  762. Bacillus sp. YC2 tRNA-Gly
  763. Bacillus sp. YH3-2-B2 tRNA-Gly
  764. Bacillus sp. YIM B13410 tRNA-Gly
  765. Bacillus sp. YIM B13433 tRNA-Gly
  766. Bacillus sp. YIM B13449 tRNA-Gly
  767. Bacillus sp. YIM B13590 tRNA-Gly
  768. Bacillus sp. YP1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  769. Alteribacter lacisalsi tRNA-Gly
  770. Bacillus sp. z60-10 tRNA-Gly
  771. Bacillus sp. z60-11 tRNA-Gly
  772. Bacillus sp. z60-18 tRNA-Gly
  773. Bacillus sp. ZCB01 tRNA-Gly
  774. Bacillus sp. ZHX3 tRNA-Gly
  775. Bacillus sp. ZY-1-1 tRNA-Gly
  776. Bacillus stercoris tRNA-Gly
  777. Bacillus stratosphericus tRNA-Gly
  778. Bacillus suaedaesalsae tRNA-Gly
  779. Bacillus subtilis BEST7003 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  780. Bacillus subtilis BEST7613 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  781. Bacillus subtilis BSn5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  782. Bacillus subtilis E1 tRNA-Gly-GCC
  783. Bacillus subtilis HJ5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  784. Bacillus subtilis J22 tRNA-Gly
  785. Bacillus subtilis J23 tRNA-Gly
  786. Bacillus subtilis J24 tRNA-Gly
  787. Bacillus subtilis J25 tRNA-Gly
  788. Bacillus subtilis J26 tRNA-Gly
  789. Bacillus subtilis J27 tRNA-Gly
  790. Bacillus subtilis KCTC 1028 = ATCC 6051a = ATCC 6051a tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  791. Bacillus subtilis MB73/2 tRNA-Gly
  792. Bacillus subtilis PY79 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  793. Bacillus subtilis QB928 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  794. Bacillus subtilis QH-1 tRNA-Gly
  795. Bacillus inaquosorum KCTC 13429 tRNA-Gly
  796. Bacillus subtilis subsp. natto BEST195 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  797. Bacillus subtilis subsp. natto tRNA-Gly
  798. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  799. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Gly
  800. Bacillus subtilis subsp. subtilis str. 168 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  801. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  802. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  803. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  804. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  805. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  806. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  807. Bacillus subtilis subsp. subtilis str. SC-8 tRNA-Gly
  808. Bacillus subtilis subsp. subtilis str. SMY tRNA-Gly
  809. Bacillus subtilis subsp. subtilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  810. Bacillus subtilis TO-A tRNA-Gly
  811. Bacillus subtilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  812. Bacillus subtilis XF-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  813. Bacillus swezeyi tRNA-Gly
  814. Bacillus taeanensis tRNA-Gly
  815. Evansella tamaricis tRNA-Gly
  816. Bacillus tequilensis tRNA-Gly(gcc)
  817. Bacillus thuringiensis tRNA-Gly
  818. Sutcliffiella tianshenii tRNA-Gly
  819. Bacillus timonensis tRNA-Gly
  820. Alkalihalobacillus trypoxylicola tRNA-Gly
  821. Bacillus vallismortis tRNA-Gly
  822. Bacillus velezensis AS43.3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  823. Bacillus velezensis CAU B946 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  824. Bacillus velezensis FZB42 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  825. Bacillus velezensis NAU-B3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  826. Bacillus velezensis NJN-6 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  827. Bacillus velezensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  828. Bacillus velezensis UCMB5033 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  829. Bacillus velezensis UCMB5036 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  830. Bacillus velezensis UCMB5113 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  831. Bacillus velezensis YAU B9601-Y2 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  832. Rossellomorea vietnamensis tRNA-Gly
  833. Heyndrickxia vini tRNA-Gly
  834. Metabacillus harenarius tRNA-Gly
  835. Pseudobacillus wudalianchiensis tRNA-Gly
  836. Bacillus xiamenensis tRNA-Gly
  837. Bacillus xiapuensis tRNA-Gly
  838. Bacillus zhangzhouensis tRNA-Gly
  839. bacterium 16_S56 tRNA-Gly
  840. bacterium 1XD42-44 tRNA-Gly
  841. Allobosea sp. NPDC055353 Bosea sp. NPDC055353 tRNA-Gly
  842. Bradyrhizobium sp. tRNA-Gly
  843. Peribacillus frigoritolerans tRNA-Gly
  844. Caldibacillus thermoamylovorans tRNA-Gly
  845. Caldifermentibacillus hisashii tRNA-Gly
  846. Campylobacter jejuni tRNA-Gly
  847. Cerasibacillus sp. JNUCC 74 tRNA-Gly
  848. Chungangia koreensis tRNA-Gly
  849. Citrobacter freundii tRNA-Gly
  850. Citrobacter sp. VF227 tRNA-Gly
  851. Clavibacter michiganensis tRNA-Gly
  852. Clostridium sp. 1xD42-85 tRNA-Gly
  853. Corynebacterium diphtheriae tRNA-Gly
  854. Cutibacterium acnes tRNA-Gly
  855. Cyanobacterium aponinum 0216 tRNA-Gly
  856. Cytobacillus citreus tRNA-Gly
  857. Cytobacillus eiseniae tRNA-Gly
  858. Cytobacillus gottheilii tRNA-Gly
  859. Cytobacillus mangrovibacter tRNA-Gly
  860. Cytobacillus oceanisediminis tRNA-Gly
  861. Cytobacillus praedii tRNA-Gly
  862. Cytobacillus solani tRNA-Gly
  863. Cytobacillus sp. Hm23 tRNA-Gly
  864. Cytobacillus sp. IB215316 tRNA-Gly
  865. Cytobacillus sp. IB215665 tRNA-Gly
  866. Cytobacillus spongiae tRNA-Gly
  867. Cytobacillus sp. S13-E01 tRNA-Gly
  868. Desertibacillus haloalkaliphilus tRNA-Gly
  869. Embleya sp. NPDC055664 tRNA-Gly
  870. Embleya sp. NPDC056575 tRNA-Gly
  871. Enterobacter cloacae tRNA-Gly
  872. Enterococcus faecalis tRNA-Gly
  873. Enterococcus faecium tRNA-Gly
  874. Escherichia coli tRNA-Gly
  875. Evansella alkalicola tRNA-Gly
  876. Falsibacillus albus tRNA-Gly
  877. Ferdinandcohnia sp. SAFN-114 tRNA-Gly
  878. Filobacillus milosensis tRNA-Gly
  879. Flavisolibacter sp. tRNA-Gly
  880. Fredinandcohnia humi tRNA-Gly
  881. Fredinandcohnia quinoae tRNA-Gly
  882. Fredinandcohnia salidurans tRNA-Gly
  883. Fredinandcohnia jepli Fredinandcohnia sp. 179-A 10B2 NHS tRNA-Gly
  884. Fredinandcohnia sp. FSL W7-1320 tRNA-Gly
  885. Fredinandcohnia sp. QZ13 tRNA-Gly
  886. Gracilibacillus halotolerans tRNA-Gly
  887. Gracilibacillus marinus tRNA-Gly
  888. Gracilibacillus sp. D59 tRNA-Gly
  889. Gracilibacillus sp. HCP3S3_G5_1 tRNA-Gly
  890. Gracilibacillus sp. HCP3S3_G5_2 tRNA-Gly
  891. Gracilibacillus sp. JCM 18860 tRNA-Gly
  892. Gracilibacillus sp. JCM 18966 tRNA-Gly
  893. Gracilibacillus salinarum tRNA-Gly
  894. Gracilibacillus caseinilyticus tRNA-Gly
  895. Gracilibacillus oryzae tRNA-Gly
  896. Gracilibacillus thailandensis tRNA-Gly
  897. Gracilibacillus ureilyticus tRNA_Gly_GCC
  898. Gracilibacillus xinjiangensis tRNA-Gly
  899. Guptibacillus algicola tRNA-Gly
  900. Halalkalibacter alkaliphilus tRNA-Gly
  901. Halalkalibacterium halodurans C-125 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  902. Halalkalibacterium halodurans tRNA-Gly
  903. Halalkalibacterium ligniniphilum tRNA
  904. Halalkalibacter oceani tRNA-Gly
  905. Halalkalibacter sp. HAAS-P013 tRNA-Gly
  906. Halalkalibacter wakoensis tRNA-Gly
  907. Halobacillaceae bacterium ABV2_076 tRNA-Gly
  908. Halobacillus andaensis tRNA-Gly
  909. Halobacillus campisalis tRNA-Gly
  910. Halobacillus dabanensis tRNA_Gly_GCC
  911. Halobacillus halophilus DSM 2266 tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  912. Halobacillus halophilus tRNA-Gly
  913. Halobacillus karajensis tRNA-Gly
  914. Halobacillus litoralis tRNA-Gly
  915. Halobacillus mangrovi tRNA-Gly
  916. Halobacillus naozhouensis tRNA-Gly
  917. Halobacillus salinus tRNA-Gly
  918. Halobacillus seohaensis tRNA-Gly
  919. Halobacillus sp. A1-3 tRNA-Gly
  920. Halobacillus sp. A1 tRNA-Gly
  921. Halobacillus sp. A5 tRNA-Gly
  922. Halobacillus sp. ABR2_026 tRNA-Gly
  923. Halobacillus sp. ACCC02827 tRNA-Gly
  924. Halobacillus sp. AWM4_238 tRNA-Gly
  925. Halobacillus sp. B23F22_1 tRNA-Gly
  926. Halobacillus sp. B23F22_5 tRNA-Gly
  927. Halobacillus sp. B29 tRNA-Gly
  928. Halobacillus sp. BBL2006 tRNA-Gly
  929. Halobacillus sp. GSS1 tRNA-Gly
  930. Halobacillus sp. H74 tRNA-Gly
  931. Halobacillus sp. HZG1 tRNA-Gly
  932. Halobacillus sp. K22 tRNA-Gly
  933. Halobacillus yeomjeoni tRNA-Gly
  934. Halobacillus sp. MO56 tRNA-Gly
  935. Halobacillus sp. Nhm2S1 tRNA-Gly
  936. Halobacillus fulvus tRNA-Gly
  937. Halobacillus salinarum tRNA-Gly
  938. Halobacillus amylolyticus tRNA-Gly
  939. Halobacillus shinanisalinarum tRNA-Gly
  940. Halobacillus sp. SY10 tRNA-Gly
  941. Halobacillus trueperi tRNA-Gly
  942. Halobacillus yeomjeoni tRNA-Gly
  943. Heyndrickxia acidicola tRNA-Gly
  944. Heyndrickxia camelliae tRNA-Gly
  945. Heyndrickxia ginsengihumi tRNA-Gly
  946. Heyndrickxia oleronia tRNA-Gly
  947. Heyndrickxia shackletonii tRNA-Gly
  948. Heyndrickxia sp. FSL K6-6286 tRNA-Gly
  949. Heyndrickxia sp. FSL W8-0423 tRNA-Gly
  950. Heyndrickxia sp. FSL W8-0496 tRNA-Gly
  951. Heyndrickxia sp. FW510-T9 tRNA-Gly
  952. Heyndrickxia sp. NPDC080065 tRNA-Gly
  953. Heyndrickxia sporothermodurans tRNA-Gly
  954. Isoptericola sp. NPDC056573 tRNA-Gly
  955. Jeotgalicoccus coquinae tRNA-Gly
  956. Phocicoccus pinnipedialis tRNA-Gly
  957. Phocicoccus schoeneichii tRNA-Gly
  958. Jeotgalicoccus meleagridis tRNA-Gly
  959. Jeotgalicoccus sp. tRNA-Gly
  960. Kitasatospora cineracea tRNA-Gly
  961. Kitasatospora sp. NPDC054939 tRNA-Gly
  962. Kitasatospora sp. NPDC056184 tRNA-Gly
  963. Kitasatospora sp. NPDC058162 tRNA-Gly
  964. Klebsiella aerogenes tRNA-Gly
  965. Klebsiella pneumoniae tRNA-Gly
  966. Klebsiella quasipneumoniae tRNA-Gly
  967. Lentilactobacillus parakefiri tRNA-Gly
  968. Lederbergia citrea tRNA-Gly
  969. Lederbergia citrisecunda tRNA-Gly
  970. Lederbergia citri tRNA-Gly
  971. Lederbergia galactosidilytica tRNA-Gly
  972. Lederbergia graminis tRNA-Gly
  973. Lederbergia panacisoli tRNA-Gly
  974. Lederbergia wuyishanensis tRNA-Gly
  975. Leeuwenhoekiella sp. tRNA-Gly
  976. Lentibacillus amyloliquefaciens tRNA-Gly
  977. Lentibacillus halophilus tRNA-Gly
  978. Lentibacillus juripiscarius tRNA-Gly
  979. Lentibacillus kapialis tRNA-Gly
  980. Lentibacillus populi tRNA-Gly
  981. Lentibacillus sp. CBA3610 tRNA-Gly
  982. Lentibacillus sp. JNUCC-1 tRNA-Gly
  983. Lentibacillus sp. L22 tRNA-Gly
  984. Lentibacillus songyuanensis Lentibacillus sp. N15 tRNA-Gly
  985. Lentibacillus cibarius tRNA-Gly
  986. Lentibacillus cibarius tRNA-Gly
  987. Lentibacillus lipolyticus tRNA-Gly
  988. Ligilactobacillus ruminis tRNA-Gly
  989. Listeria monocytogenes tRNA-Gly
  990. Litchfieldia luteola tRNA-Gly
  991. Litchfieldia salsa tRNA-Gly
  992. Lysinibacillus sphaericus tRNA-Gly
  993. Mangrovibacillus sp. Mu-81 tRNA-Gly
  994. Margalitia sp. FSL K6-0131 tRNA-Gly
  995. marine sediment metagenome tRNA
  996. Marinococcus halophilus tRNA-Gly
  997. Marinococcus luteus tRNA-Gly
  998. Marinococcus sp. PL1-022 tRNA-Gly
  999. Marinomonas profundimaris tRNA-Gly
  1000. Massilibacterium sp. tRNA-Gly
  1001. Metabacillus bambusae tRNA-Gly
  1002. Metabacillus crassostreae tRNA-Gly
  1003. Metabacillus dongyingensis tRNA-Gly
  1004. Metabacillus endolithicus tRNA-Gly
  1005. Metabacillus fastidiosus tRNA-Gly
  1006. Metabacillus halosaccharovorans tRNA-Gly
  1007. Metabacillus hrfriensis tRNA-Gly
  1008. Metabacillus idriensis tRNA-Gly
  1009. Metabacillus indicus tRNA-Gly
  1010. Metabacillus kandeliae tRNA-Gly
  1011. Metabacillus lacus tRNA-Gly
  1012. Metabacillus litoralis tRNA-Gly
  1013. Metabacillus malikii tRNA-Gly
  1014. Metabacillus mangrovi tRNA-Gly
  1015. Metabacillus niabensis tRNA-Gly
  1016. Metabacillus rhizolycopersici tRNA-Gly
  1017. Metabacillus sp. 113a tRNA-Gly
  1018. Metabacillus sp. 22489 tRNA-Gly
  1019. Metabacillus sp. 84 tRNA-Gly
  1020. Metabacillus sp. B2-18 tRNA-Gly
  1021. Metabacillus sediminis Metabacillus sp. FJAT-52054 tRNA-Gly
  1022. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Gly
  1023. Metabacillus harenarius Metabacillus sp. HB246100 tRNA-Gly
  1024. Metabacillus sp. Hm71 tRNA-Gly
  1025. Metabacillus mesotrionivorans Metabacillus sp. JX24 tRNA-Gly
  1026. Metabacillus sp. KH_069 tRNA-Gly
  1027. Metabacillus flavus tRNA-Gly
  1028. Metabacillus sp. KJ11-3 tRNA-Gly
  1029. Metabacillus elymi tRNA-Gly
  1030. Chryseobacillus diguaensis Metabacillus sp. RGM 3146 tRNA-Gly
  1031. Metabacillus sp. SLBN-84 tRNA-Gly
  1032. Metabacillus sp. tRNA-Gly
  1033. Microbacterium enclense tRNA-Gly
  1034. Microbacterium sp. NPDC055442 tRNA-Gly
  1035. Micrococcus luteus tRNA-Gly
  1036. Micromonospora chalcea tRNA-Gly
  1037. Micromonospora sp. 1209 tRNA-Gly
  1038. Micromonospora tulbaghiae tRNA
  1039. Mycobacteroides abscessus subsp. abscessus tRNA-Gly(gcc)
  1040. Mycobacteroides abscessus subsp. massiliense tRNA-Gly(gcc)
  1041. Nanhaiella sioensis tRNA-Gly
  1042. Negativibacillus sp. 1xD8-3 tRNA-Gly
  1043. Neisseria gonorrhoeae tRNA-Gly
  1044. Neobacillus bataviensis tRNA-Gly
  1045. Neobacillus canaveralius tRNA-Gly
  1046. Neobacillus citreus tRNA-Gly
  1047. Neobacillus cucumis tRNA-Gly
  1048. Neobacillus drentensis tRNA-Gly
  1049. Neobacillus driksii tRNA-Gly
  1050. Neobacillus endophyticus tRNA-Gly
  1051. Neobacillus ginsengisoli tRNA-Gly
  1052. Neobacillus kokaensis tRNA-Gly
  1053. Neobacillus niacini tRNA-Gly
  1054. Neobacillus novalis tRNA-Gly
  1055. Neobacillus paridis tRNA-Gly
  1056. Neobacillus phoenicis tRNA-Gly
  1057. Neobacillus pocheonensis tRNA-Gly
  1058. Neobacillus rhizophilus tRNA-Gly
  1059. Neobacillus sedimentimangrovi tRNA-Gly
  1060. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Gly
  1061. Neobacillus sp. 19 tRNA-Gly
  1062. Neobacillus sp. 204 tRNA-Gly
  1063. Neobacillus sp. B24 tRNA-Gly
  1064. Neobacillus sp. CF12 tRNA-Gly
  1065. Neobacillus sp. D3-1R tRNA-Gly
  1066. Neobacillus sp. DFD-2R tRNA-Gly
  1067. Neobacillus sp. DY30 tRNA-Gly
  1068. Neobacillus sp. Fa239 tRNA-Gly
  1069. Neobacillus sp. FW104-15D2 tRNA-Gly
  1070. Neobacillus sp. GCM10023253 tRNA-Gly
  1071. Neobacillus sp. GCM10027624 tRNA-Gly
  1072. Neobacillus rhizosphaerae tRNA-Gly
  1073. Neobacillus sp. K501 tRNA-Gly
  1074. Neobacillus sp. KR4-4 tRNA-Gly
  1075. Neobacillus solisequens Neobacillus sp. LXY-1 tRNA-Gly
  1076. Neobacillus terrisolis Neobacillus sp. LXY-4 tRNA-Gly
  1077. Neobacillus sp. M.A.Huq-85 tRNA-Gly
  1078. Neobacillus sp. MER 74 tRNA-Gly
  1079. Neobacillus sp. NPDC058068 tRNA-Gly
  1080. Neobacillus sp. NPDC093127 tRNA-Gly
  1081. Neobacillus sp. NPDC093182 tRNA-Gly
  1082. Neobacillus sp. NPDC097160 tRNA-Gly
  1083. Neobacillus sp. NRS-1170 tRNA-Gly
  1084. Neobacillus sp. OS1-32 tRNA-Gly
  1085. Neobacillus sp. PS2-9 tRNA-Gly
  1086. Neobacillus sp. PS3-34 tRNA-Gly
  1087. Neobacillus sp. PVCKKU3 tRNA-Gly
  1088. Neobacillus sp. S1115 tRNA-Gly
  1089. Neobacillus sp. S1227 tRNA-Gly
  1090. Neobacillus sp. SAB-20_R2A tRNA-Gly
  1091. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Gly
  1092. Neobacillus sp. SM06 tRNA-Gly
  1093. Neobacillus sp. SuZ13 tRNA-Gly
  1094. Neobacillus sp. tRNA-Gly
  1095. Neobacillus sp. WH10 tRNA-Gly
  1096. Neobacillus sp. YX16 tRNA-Gly
  1097. Neobacillus terrae tRNA-Gly
  1098. Neobacillus thermocopriae tRNA-Gly
  1099. Neobacillus vireti tRNA-Gly
  1100. Niallia hominis tRNA-Gly
  1101. Niallia oryzisoli tRNA-Gly
  1102. Niallia sp. 01092 tRNA-Gly
  1103. Niallia sp. FSL K6-0077 tRNA-Gly
  1104. Niallia sp. FSL K6-0212 tRNA-Gly
  1105. Niallia sp. FSL M8-0099 tRNA-Gly
  1106. Niallia sp. FSL R7-0648 tRNA-Gly
  1107. Niallia sp. FSL W8-0177 tRNA-Gly
  1108. Niallia sp. FSL W8-0635 tRNA-Gly
  1109. Niallia sp. FSL W8-0951 tRNA-Gly
  1110. Niallia sp. FSL W8-0954 tRNA-Gly
  1111. Niallia sp. FSL W8-1348 tRNA-Gly
  1112. Niallia sp. HCP3S3_B10 tRNA-Gly
  1113. Niallia tiangongensis Niallia sp. JL1B1071 tRNA-Gly
  1114. Niallia sp. Kr1 Niallia sp. Krafla_26 tRNA-Gly
  1115. Niallia sp. MER TA 168 tRNA-Gly
  1116. Niallia sp. RD1 tRNA-Gly
  1117. Niallia sp. Sow4_A1 tRNA-Gly
  1118. Niallia sp. tRNA-Gly
  1119. Niallia sp. XMNu-256 tRNA-Gly
  1120. Nocardia panacis tRNA-Gly
  1121. Nocardiopsis alba tRNA-Gly
  1122. Nocardiopsis dassonvillei tRNA-Gly
  1123. Nosocomiicoccus ampullae tRNA-Gly
  1124. Nosocomiicoccus massiliensis tRNA-Gly
  1125. Nosocomiicoccus sp. HMSC067E10 tRNA-Gly
  1126. Nosocomiicoccus sp. HMSC09A07 tRNA-Gly
  1127. Oceanobacillus aidingensis tRNA-Gly
  1128. Oceanobacillus alkalisoli tRNA-Gly
  1129. Oceanobacillus arenosus tRNA-Gly
  1130. Oceanobacillus caeni tRNA-Gly
  1131. Oceanobacillus chungangensis tRNA-Gly
  1132. Oceanobacillus halophilus tRNA-Gly
  1133. Oceanobacillus iheyensis HTE831 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  1134. Oceanobacillus iheyensis tRNA-Gly
  1135. Oceanobacillus indicireducens tRNA-Gly
  1136. Oceanobacillus jeddahensis tRNA-Gly
  1137. Oceanobacillus jordanicus tRNA-Gly
  1138. Oceanobacillus kapialis tRNA-Gly
  1139. Oceanobacillus kimchii tRNA-Gly
  1140. Oceanobacillus locisalsi tRNA-Gly
  1141. Oceanobacillus longus tRNA-Gly
  1142. Oceanobacillus luteolus tRNA-Gly
  1143. Oceanobacillus oncorhynchi subsp. incaldanensis tRNA-Gly
  1144. Oceanobacillus oncorhynchi subsp. oncorhynchi tRNA-Gly
  1145. Oceanobacillus oncorhynchi tRNA-Gly
  1146. Oceanobacillus phoenicis tRNA-Gly
  1147. Oceanobacillus picturae tRNA-Gly
  1148. Oceanobacillus polygoni tRNA-Gly
  1149. Oceanobacillus profundus tRNA-Gly
  1150. Oceanobacillus sp. 143 tRNA-Gly
  1151. Oceanobacillus zhaokaii tRNA-Gly
  1152. Oceanobacillus sp. CAU 1775 tRNA-Gly
  1153. Oceanobacillus sp. E9 tRNA-Gly
  1154. Oceanobacillus sp. FSL H7-0719 tRNA-Gly
  1155. Oceanobacillus sp. FSL K6-0118 tRNA-Gly
  1156. Oceanobacillus sp. FSL K6-0127 tRNA-Gly
  1157. Oceanobacillus sp. FSL K6-0251 tRNA-Gly
  1158. Oceanobacillus sp. FSL K6-2867 tRNA-Gly
  1159. Oceanobacillus sp. FSL W7-1281 tRNA-Gly
  1160. Oceanobacillus sp. FSL W7-1293 tRNA-Gly
  1161. Oceanobacillus sp. FSL W7-1304 tRNA-Gly
  1162. Oceanobacillus sp. FSL W7-1309 tRNA-Gly
  1163. Oceanobacillus sp. HCA-5259 tRNA-Gly
  1164. Oceanobacillus sp. ISL-73 tRNA-Gly
  1165. Oceanobacillus sp. ISL-74 tRNA-Gly
  1166. Oceanobacillus sp. J11TS1 tRNA-Gly
  1167. Oceanobacillus sp. M65 tRNA-Gly
  1168. Oceanobacillus sp. MO10714A tRNA-Gly
  1169. Oceanobacillus sp. SE10311 tRNA-Gly
  1170. Oceanobacillus piezotolerans tRNA-Gly
  1171. Oikeobacillus pervagus tRNA-Gly
  1172. Ornithinibacillus bavariensis tRNA-Gly
  1173. Ornithinibacillus caprae tRNA-Gly
  1174. Ornithinibacillus halotolerans tRNA-Gly
  1175. Ornithinibacillus hominis tRNA-Gly
  1176. Ornithinibacillus massiliensis tRNA-Gly
  1177. Ornithinibacillus salinisoli tRNA-Gly
  1178. Ornithinibacillus xuwenensis Ornithinibacillus sp. 16A2E tRNA-Gly
  1179. Ornithinibacillus jepli Ornithinibacillus sp. 179-J 7C1 HS tRNA-Gly
  1180. Ornithinibacillus liuyingii Ornithinibacillus sp. 27F3 tRNA-Gly
  1181. Ornithinibacillus sp. FSL M8-0202 tRNA-Gly
  1182. Ornithinibacillus proteolyticus Ornithinibacillus sp. JPR2-1 tRNA-Gly
  1183. Paenibacillus sp. BSR1-1 tRNA-Gly
  1184. Paenibacillus sp. FSL M7-1455 tRNA-Gly
  1185. Pallidibacillus pasinlerensis tRNA-Gly
  1186. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Gly
  1187. Pantoea sp. tRNA-Gly
  1188. Paraburkholderia sp. SIMBA_058 tRNA-Gly
  1189. Paraburkholderia tropica tRNA-Gly
  1190. Perspicuibacillus lycopersici tRNA-Gly
  1191. Piscibacillus salipiscarius tRNA-Gly
  1192. Piscibacillus sp. B03 tRNA-Gly
  1193. Planococcus sp. SIMBA_143 tRNA-Gly
  1194. Plantactinospora veratri tRNA-Gly
  1195. Pontibacillus chungwhensis BH030062 tRNA-Gly
  1196. Pontibacillus chungwhensis tRNA-Gly
  1197. Pontibacillus litoralis JSM 072002 tRNA-Gly
  1198. Pontibacillus salicampi tRNA-Gly
  1199. Pontibacillus salipaludis tRNA-Gly
  1200. Pontibacillus sp. ABV4_188 tRNA-Gly
  1201. Pontibacillus sp. ALD_SL1 tRNA-Gly
  1202. Pontibacillus sp. HMF3514 tRNA-Gly
  1203. Pontibacillus sp. HN14 tRNA-Gly
  1204. Pontibacillus yanchengensis tRNA-Gly
  1205. Pontibacillus yanchengensis Y32 tRNA-Gly
  1206. Pradoshia eiseniae tRNA-Gly
  1207. Pradoshia sp. D12 tRNA-Gly
  1208. Pradoshia sp. tRNA-Gly
  1209. Priestia iocasae tRNA-Gly
  1210. Priestia sp. WB3 tRNA-Gly
  1211. Pseudalkalibacillus sp. A8 tRNA-Gly
  1212. Pseudalkalibacillus sp. Hm43 tRNA-Gly
  1213. Pseudalkalibacillus sp. R45 tRNA-Gly
  1214. Pseudalkalibacillus nanhaiensis Pseudalkalibacillus sp. SCS-8 tRNA-Gly
  1215. Pseudobacillus badius tRNA-Gly
  1216. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Gly
  1217. Pseudobacillus sp. FSL P4-0506 tRNA-Gly
  1218. Pseudoclavibacter sp. RFBJ3 tRNA-Gly
  1219. Pseudomonas aeruginosa tRNA-Gly
  1220. Bacillus subtilis A29 tRNA-Gly
  1221. Pseudomonas sp. EGD-AK9 tRNA-Gly
  1222. Pseudomonas sp. GW456-E7 tRNA-Gly
  1223. Pseudomonas sp. ISL-88 tRNA-Gly
  1224. Pseudoneobacillus rhizosphaerae tRNA-Gly
  1225. Pseudoneobacillus sp. C159 tRNA-Gly
  1226. Pseudoneobacillus sp. tRNA-Gly
  1227. Pullulanibacillus camelliae tRNA-Gly
  1228. Pullulanibacillus pueri tRNA-Gly
  1229. Radiobacillus kanasensis tRNA-Gly
  1230. Ralstonia insidiosa tRNA-Gly
  1231. Rathayibacter sp. RFBD1 tRNA-Gly
  1232. Rathayibacter toxicus tRNA-Gly
  1233. Rathayibacter tritici tRNA-Gly
  1234. Martinezella rhizogenes tRNA-Gly
  1235. Rhizobium ruizarguesonis tRNA-Gly
  1236. Rhodococcus cercidiphylli tRNA-Gly
  1237. Rhodococcus koreensis tRNA-Gly
  1238. Rhodococcus qingshengii tRNA-Gly
  1239. Rhodococcus zopfii tRNA-Gly
  1240. Anoxybacillus andreesenii tRNA-Gly
  1241. Robertmurraya crescens tRNA-Gly
  1242. Robertmurraya massiliosenegalensis tRNA-Gly
  1243. Robertmurraya phoenicis tRNA-Gly
  1244. Robertmurraya siralis tRNA-Gly
  1245. Robertmurraya sp. DFI.2.37 tRNA-Gly
  1246. Robertmurraya sp. FSL W8-0741 tRNA-Gly
  1247. Roseburia sp. 1XD42-34 tRNA-Gly
  1248. Rossellomorea aquimaris tRNA-Gly
  1249. Rossellomorea arthrocnemi tRNA-Gly
  1250. Rossellomorea orangium tRNA-Gly
  1251. Rossellomorea oryzaecorticis tRNA-Gly
  1252. Rossellomorea sedimentorum tRNA-Gly
  1253. Rossellomorea sp. ABR4_004 tRNA-Gly
  1254. Rossellomorea sp. ABR4_012 tRNA-Gly
  1255. Rossellomorea sp. AcN35-11 tRNA-Gly
  1256. Rossellomorea sp. BNER tRNA-Gly
  1257. Rossellomorea sp. DA94 tRNA-Gly
  1258. Rossellomorea sp. DUT-2 tRNA-Gly
  1259. Rossellomorea sp. FS2 tRNA-Gly
  1260. Rossellomorea sp. GCM10028870 tRNA-Gly
  1261. Rossellomorea sp. H39__3 tRNA-Gly
  1262. Rossellomorea sp. KS-H15a tRNA-Gly
  1263. Rossellomorea sp. LJF3 tRNA-Gly
  1264. Rossellomorea sp. LjRoot5 tRNA-Gly
  1265. Rossellomorea sp. NPDC071047 tRNA-Gly
  1266. Rossellomorea sp. NPDC077527 tRNA-Gly
  1267. Rossellomorea sp. NRS-1567 tRNA-Gly
  1268. Rossellomorea sp. NS-SX7 tRNA-Gly
  1269. Rossellomorea sp. QJM3NY_18 tRNA-Gly
  1270. Rossellomorea sp. SC111 tRNA-Gly
  1271. Rossellomorea sp. y25 tRNA-Gly
  1272. Rossellomorea sp. YZS02 tRNA-Gly
  1273. Rossellomorea yichunensis tRNA-Gly
  1274. Salibacterium aidingense tRNA-Gly
  1275. Salibacterium lacus tRNA-Gly
  1276. Salibacterium qingdaonense tRNA_Gly_GCC
  1277. Salibacterium salarium tRNA-Gly
  1278. Salibacterium sp. K-3 tRNA-Gly
  1279. Salinibacillus aidingensis tRNA-Gly
  1280. Salinibacillus xinjiangensis tRNA-Gly
  1281. Salinicoccus halitifaciens tRNA-Gly
  1282. Salinicoccus jeotgali tRNA-Gly
  1283. Salinicoccus roseus tRNA-Gly
  1284. Salinicoccus siamensis tRNA-Gly
  1285. Salinicoccus bachuensis Salinicoccus sp. Bachu38 tRNA-Gly
  1286. Salinicoccus sp. CNSTN-B1 tRNA-Gly
  1287. Salinicoccus sp. RF5 tRNA-Gly
  1288. Salinimicrobium profundisediminis tRNA-Gly
  1289. Salirhabdus euzebyi tRNA-Gly
  1290. Salirhabdus salicampi tRNA-Gly
  1291. Salmonella enterica subsp. enterica serovar Stanley tRNA-Gly
  1292. Salmonella enterica tRNA-Gly
  1293. Schinkia azotoformans tRNA-Gly
  1294. Schinkia acidoalkalinis Schinkia sp. CFF1 tRNA-Gly
  1295. Sediminibacillus dalangtanensis tRNA-Gly
  1296. Shigella flexneri tRNA-Gly
  1297. soil metagenome tRNA
  1298. Bacillus velezensis A3 tRNA-Gly
  1299. Staphylococcaceae bacterium DP2N0-1 tRNA-Gly
  1300. Staphylococcus aureus tRNA-Gly
  1301. Staphylococcus borealis tRNA-Gly
  1302. Staphylococcus caledonicus tRNA-Gly
  1303. Staphylococcus capitis C87 tRNA-Gly
  1304. Staphylococcus capitis SK14 tRNA-Gly
  1305. Staphylococcus capitis subsp. capitis tRNA-Gly
  1306. Staphylococcus capitis subsp. urealyticus tRNA-Gly
  1307. Staphylococcus capitis tRNA-Gly
  1308. Staphylococcus capitis VCU116 tRNA-Gly
  1309. Staphylococcus caprae tRNA-Gly
  1310. Staphylococcus carnosus tRNA-Gly
  1311. Staphylococcus devriesei tRNA-Gly
  1312. Staphylococcus epidermidis 14.1.R1.SE tRNA-Gly
  1313. Staphylococcus epidermidis 41tr tRNA-Gly
  1314. Staphylococcus epidermidis 528m tRNA-Gly
  1315. Staphylococcus epidermidis APO27 tRNA-Gly
  1316. Staphylococcus epidermidis ATCC 12228 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1317. Staphylococcus epidermidis AU12-03 tRNA-Gly
  1318. Staphylococcus epidermidis BCM-HMP0060 tRNA-Gly
  1319. Staphylococcus epidermidis BVS058A4 tRNA-Gly
  1320. Staphylococcus epidermidis CIM28 tRNA-Gly
  1321. Staphylococcus epidermidis CIM40 tRNA-Gly
  1322. Staphylococcus epidermidis FRI909 tRNA-Gly
  1323. Staphylococcus epidermidis FS1 tRNA-Gly
  1324. Staphylococcus epidermidis IS-250 tRNA-Gly
  1325. Staphylococcus epidermidis IS-K tRNA-Gly
  1326. Staphylococcus epidermidis M0026 tRNA-Gly
  1327. Staphylococcus epidermidis M0881 tRNA-Gly
  1328. Staphylococcus epidermidis M23864:W2(grey) (grey) tRNA-Gly
  1329. Staphylococcus epidermidis MC28 tRNA-Gly
  1330. Staphylococcus epidermidis NIH04003 tRNA-Gly
  1331. Staphylococcus epidermidis NIH04008 tRNA-Gly
  1332. Staphylococcus epidermidis NIH05001 tRNA-Gly
  1333. Staphylococcus epidermidis NIH05003 tRNA-Gly
  1334. Staphylococcus epidermidis NIH05005 tRNA-Gly
  1335. Staphylococcus epidermidis NIH051475 tRNA-Gly
  1336. Staphylococcus epidermidis NIH051668 tRNA-Gly
  1337. Staphylococcus epidermidis NIH06004 tRNA-Gly
  1338. Staphylococcus epidermidis NIH08001 tRNA-Gly
  1339. Staphylococcus epidermidis NIHLM001 tRNA-Gly
  1340. Staphylococcus epidermidis NIHLM003 tRNA-Gly
  1341. Staphylococcus epidermidis NIHLM008 tRNA-Gly
  1342. Staphylococcus epidermidis NIHLM015 tRNA-Gly
  1343. Staphylococcus epidermidis NIHLM018 tRNA-Gly
  1344. Staphylococcus epidermidis NIHLM020 tRNA-Gly
  1345. Staphylococcus epidermidis NIHLM021 tRNA-Gly
  1346. Staphylococcus epidermidis NIHLM023 tRNA-Gly
  1347. Staphylococcus epidermidis NIHLM031 tRNA-Gly
  1348. Staphylococcus epidermidis NIHLM037 tRNA-Gly
  1349. Staphylococcus epidermidis NIHLM039 tRNA-Gly
  1350. Staphylococcus epidermidis NIHLM040 tRNA-Gly
  1351. Staphylococcus epidermidis NIHLM049 tRNA-Gly
  1352. Staphylococcus epidermidis NIHLM053 tRNA-Gly
  1353. Staphylococcus epidermidis NIHLM057 tRNA-Gly
  1354. Staphylococcus epidermidis NIHLM061 tRNA-Gly
  1355. Staphylococcus epidermidis NIHLM067 tRNA-Gly
  1356. Staphylococcus epidermidis NIHLM070 tRNA-Gly
  1357. Staphylococcus epidermidis NIHLM087 tRNA-Gly
  1358. Staphylococcus epidermidis NIHLM088 tRNA-Gly
  1359. Staphylococcus epidermidis NIHLM095 tRNA-Gly
  1360. Staphylococcus epidermidis PM221 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1361. Staphylococcus epidermidis RP62A tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1362. Staphylococcus epidermidis Scl19 tRNA-Gly
  1363. Staphylococcus epidermidis SK135 tRNA-Gly
  1364. Staphylococcus epidermidis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1365. Staphylococcus epidermidis VCU028 tRNA-Gly
  1366. Staphylococcus epidermidis VCU037 tRNA-Gly
  1367. Staphylococcus epidermidis VCU041 tRNA-Gly
  1368. Staphylococcus epidermidis VCU045 tRNA-Gly
  1369. Staphylococcus epidermidis VCU057 tRNA-Gly
  1370. Staphylococcus epidermidis VCU065 tRNA-Gly
  1371. Staphylococcus epidermidis VCU071 tRNA-Gly
  1372. Staphylococcus epidermidis VCU105 tRNA-Gly
  1373. Staphylococcus epidermidis VCU109 tRNA-Gly
  1374. Staphylococcus epidermidis VCU112 tRNA-Gly
  1375. Staphylococcus epidermidis VCU117 tRNA-Gly
  1376. Staphylococcus epidermidis VCU118 tRNA-Gly
  1377. Staphylococcus epidermidis VCU120 tRNA-Gly
  1378. Staphylococcus epidermidis VCU123 tRNA-Gly
  1379. Staphylococcus epidermidis VCU125 tRNA-Gly
  1380. Staphylococcus epidermidis VCU126 tRNA-Gly
  1381. Staphylococcus epidermidis VCU127 tRNA-Gly
  1382. Staphylococcus epidermidis VCU128 tRNA-Gly
  1383. Staphylococcus epidermidis VCU129 tRNA-Gly
  1384. Staphylococcus epidermidis VCU144 tRNA-Gly
  1385. Staphylococcus epidermidis W23144 tRNA-Gly
  1386. Staphylococcus epidermidis WI05 tRNA-Gly
  1387. Staphylococcus epidermidis WI09 tRNA-Gly
  1388. Staphylococcus equorum subsp. equorum tRNA-Gly
  1389. Staphylococcus haemolyticus JCSC1435 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1390. Staphylococcus haemolyticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1391. Staphylococcus hominis SK119 tRNA-Gly
  1392. Staphylococcus hominis subsp. hominis C80 tRNA-Gly
  1393. Staphylococcus hominis subsp. hominis tRNA-Gly
  1394. Staphylococcus hominis subsp. novobiosepticus tRNA-Gly
  1395. Staphylococcus hominis tRNA-Gly
  1396. Staphylococcus hominis VCU122 tRNA-Gly
  1397. Staphylococcus croceilyticus tRNA-Gly
  1398. Staphylococcus petrasii tRNA-Gly(gcc)
  1399. Staphylococcus petrasii subsp. petrasii tRNA-Gly(gcc)
  1400. Staphylococcus pragensis tRNA-Gly
  1401. Staphylococcus petrasii tRNA-Gly
  1402. Staphylococcus saccharolyticus tRNA-Gly
  1403. Staphylococcus saprophyticus tRNA-Gly
  1404. Staphylococcus shinii tRNA-Gly
  1405. Staphylococcus sp. 093350070-2 tRNA-Gly
  1406. Staphylococcus sp. 093350072-1 tRNA-Gly
  1407. Staphylococcus sp. 101110009-2 tRNA-Gly
  1408. Staphylococcus borealis tRNA-Gly
  1409. Staphylococcus sp. acrmy tRNA-Gly
  1410. Staphylococcus sp. EG-SA-6 tRNA-Gly
  1411. Staphylococcus sp. FR041 tRNA-Gly
  1412. Staphylococcus sp. FR124 tRNA-Gly
  1413. Staphylococcus sp. FSL C8-0035 tRNA-Gly
  1414. Staphylococcus sp. FSL H8-0476 tRNA-Gly
  1415. Staphylococcus sp. FSL K6-0099 tRNA-Gly
  1416. Staphylococcus sp. FSL K6-0223 tRNA-Gly
  1417. Staphylococcus sp. FSL M7-0405 tRNA-Gly
  1418. Staphylococcus sp. FSL M8-0207 tRNA-Gly
  1419. Staphylococcus sp. FSL W8-0097 tRNA-Gly
  1420. Staphylococcus sp. FSL W8-0304 tRNA-Gly
  1421. Staphylococcus sp. FSL W8-0436 tRNA-Gly
  1422. Staphylococcus sp. FSL W8-1268 tRNA-Gly
  1423. Staphylococcus sp. FSL W8-1270 tRNA-Gly
  1424. Staphylococcus sp. FSL W8-1291 tRNA-Gly
  1425. Staphylococcus sp. FW104-15G4D tRNA-Gly
  1426. Staphylococcus sp. GCP4 tRNA-Gly
  1427. Staphylococcus sp. GDX7P312P tRNA-Gly
  1428. Staphylococcus sp. GDX7P459A tRNA-Gly
  1429. Staphylococcus sp. HMSC034A07 tRNA-Gly
  1430. Staphylococcus sp. HMSC034C12 tRNA-Gly
  1431. Staphylococcus sp. HMSC034G11 tRNA-Gly
  1432. Staphylococcus sp. HMSC035D11 tRNA-Gly
  1433. Staphylococcus sp. HMSC035F02 tRNA-Gly
  1434. Staphylococcus sp. HMSC055A09 tRNA-Gly
  1435. Staphylococcus sp. HMSC055A10 tRNA-Gly
  1436. Staphylococcus sp. HMSC057A02 tRNA-Gly
  1437. Staphylococcus sp. HMSC057A08 tRNA-Gly
  1438. Staphylococcus sp. HMSC058D09 tRNA-Gly
  1439. Staphylococcus sp. HMSC059G05 tRNA-Gly
  1440. Staphylococcus sp. HMSC061F01 tRNA-Gly
  1441. Staphylococcus sp. HMSC061F10 tRNA-Gly
  1442. Staphylococcus sp. HMSC061G04 tRNA-Gly
  1443. Staphylococcus sp. HMSC061H04 tRNA-Gly
  1444. Staphylococcus sp. HMSC062A01 tRNA-Gly
  1445. Staphylococcus sp. HMSC062C01 tRNA-Gly
  1446. Staphylococcus sp. HMSC062C03 tRNA-Gly
  1447. Staphylococcus sp. HMSC063F02 tRNA-Gly
  1448. Staphylococcus sp. HMSC065C09 tRNA-Gly
  1449. Staphylococcus sp. HMSC065C10 tRNA-Gly
  1450. Staphylococcus sp. HMSC065D05 tRNA-Gly
  1451. Staphylococcus sp. HMSC065D11 tRNA-Gly
  1452. Staphylococcus sp. HMSC066C03 tRNA-Gly
  1453. Staphylococcus sp. HMSC067B04 tRNA-Gly
  1454. Staphylococcus sp. HMSC067G10 tRNA-Gly
  1455. Staphylococcus sp. HMSC068C09 tRNA-Gly
  1456. Staphylococcus sp. HMSC068D03 tRNA-Gly
  1457. Staphylococcus sp. HMSC068D07 tRNA-Gly
  1458. Staphylococcus sp. HMSC068G12 tRNA-Gly
  1459. Staphylococcus sp. HMSC068H08 tRNA-Gly
  1460. Staphylococcus sp. HMSC069D04 tRNA-Gly
  1461. Staphylococcus sp. HMSC069D07 tRNA-Gly
  1462. Staphylococcus sp. HMSC069D12 tRNA-Gly
  1463. Staphylococcus sp. HMSC069E07 tRNA-Gly
  1464. Staphylococcus sp. HMSC069E10 tRNA-Gly
  1465. Staphylococcus sp. HMSC070A07 tRNA-Gly
  1466. Staphylococcus sp. HMSC072D04 tRNA-Gly
  1467. Staphylococcus sp. HMSC072H03 tRNA-Gly
  1468. Staphylococcus sp. HMSC074B09 tRNA-Gly
  1469. Staphylococcus sp. HMSC074C02 tRNA-Gly
  1470. Staphylococcus sp. HMSC074C12 tRNA-Gly
  1471. Staphylococcus sp. HMSC074D07 tRNA-Gly
  1472. Staphylococcus sp. HMSC074F11 tRNA-Gly
  1473. Staphylococcus sp. HMSC075A04 tRNA-Gly
  1474. Staphylococcus sp. HMSC075F12 tRNA-Gly
  1475. Staphylococcus sp. HMSC075H09 tRNA-Gly
  1476. Staphylococcus sp. HMSC076B11 tRNA-Gly
  1477. Staphylococcus sp. HMSC076E07 tRNA-Gly
  1478. Staphylococcus sp. HMSC077B09 tRNA-Gly
  1479. Staphylococcus sp. HMSC078A03 tRNA-Gly
  1480. Staphylococcus sp. HMSC078A08 tRNA-Gly
  1481. Staphylococcus sp. HMSC078B01 tRNA-Gly
  1482. Staphylococcus sp. HMSC078D05 tRNA-Gly
  1483. Staphylococcus sp. HMSC14C01 tRNA-Gly
  1484. Staphylococcus sp. HMSC14C08 tRNA-Gly
  1485. Staphylococcus sp. HMSC34G04 tRNA-Gly
  1486. Staphylococcus sp. HMSC36A02 tRNA-Gly
  1487. Staphylococcus sp. HMSC62A08 tRNA-Gly
  1488. Staphylococcus sp. HMSC62B09 tRNA-Gly
  1489. Staphylococcus sp. M0480 tRNA-Gly
  1490. Staphylococcus sp. MB377 tRNA-Gly
  1491. Staphylococcus sp. tRNA-Gly
  1492. Staphylococcus sp. MSU001 tRNA-Gly
  1493. Staphylococcus sp. NRL 16/872 tRNA-Gly
  1494. Staphylococcus sp. NRL 18/288 tRNA-Gly
  1495. Staphylococcus sp. NRL 19/737 tRNA-Gly
  1496. Staphylococcus sp. NRL 21/187 tRNA-Gly
  1497. Staphylococcus sp. RIT622 tRNA-Gly
  1498. Staphylococcus sp. SIMBA_130 tRNA-Gly
  1499. Staphylococcus sp. SKL70935 tRNA-Gly
  1500. Staphylococcus sp. SKL71187 tRNA-Gly
  1501. Staphylococcus sp. TE8 tRNA-Gly
  1502. Staphylococcus taiwanensis tRNA-Gly
  1503. Streptococcus anginosus tRNA-Gly
  1504. Streptococcus mitis tRNA-Gly
  1505. Streptococcus pneumoniae tRNA-Gly
  1506. Streptococcus pyogenes tRNA-Gly
  1507. Streptomyces afghaniensis tRNA-Gly(gcc)
  1508. Streptomyces albidoflavus tRNA-Gly
  1509. Streptomyces anulatus tRNA-Gly
  1510. Streptomyces bikiniensis tRNA-Gly
  1511. Streptomyces chartreusis tRNA-Gly
  1512. Streptomyces cyaneofuscatus tRNA-Gly
  1513. Streptomyces goshikiensis tRNA-Gly
  1514. Streptomyces griseoincarnatus tRNA-Gly
  1515. Streptomyces griseus tRNA-Gly(gcc)
  1516. Streptomyces gulbargensis tRNA-Gly
  1517. Streptomyces hydrogenans tRNA-Gly
  1518. Streptomyces massasporeus tRNA-Gly
  1519. Streptomyces mirabilis tRNA-Gly
  1520. Streptomyces niveus tRNA-Gly
  1521. Streptomyces noursei tRNA-Gly
  1522. Streptomyces olivaceus tRNA-Gly
  1523. Streptomyces roseolus tRNA-Gly
  1524. Streptomyces rubiginosohelvolus tRNA-Gly
  1525. Streptomyces scopuliridis tRNA-Gly
  1526. Streptomyces sp. ARC32 tRNA-Gly
  1527. Streptomyces sp. NPDC053429 tRNA-Gly
  1528. Streptomyces sp. NPDC055709 tRNA-Gly
  1529. Streptomyces sp. NPDC055752 tRNA-Gly
  1530. Streptomyces sp. NPDC055753 tRNA-Gly
  1531. Streptomyces sp. NPDC056084 tRNA-Gly
  1532. Streptomyces sp. NPDC056127 tRNA-Gly
  1533. Streptomyces sp. NPDC056231 tRNA-Gly
  1534. Streptomyces sp. NPDC056647 tRNA-Gly
  1535. Streptomyces sp. NPDC056831 tRNA-Gly
  1536. Streptomyces sp. NPDC056853 tRNA-Gly
  1537. Streptomyces sp. NPDC057011 tRNA-Gly
  1538. Streptomyces sp. NPDC057582 tRNA-Gly
  1539. Streptomyces sp. NPDC057600 tRNA-Gly
  1540. Streptomyces sp. NPDC057611 tRNA-Gly
  1541. Streptomyces sp. NPDC057620 tRNA-Gly
  1542. Streptomyces sp. NPDC057748 tRNA-Gly
  1543. Streptomyces sp. NPDC057888 tRNA-Gly
  1544. Streptomyces sp. NPDC057939 tRNA-Gly
  1545. Streptomyces sp. NPDC057963 tRNA-Gly
  1546. Streptomyces sp. NPDC058001 tRNA-Gly
  1547. Streptomyces sp. NPDC058195 tRNA-Gly
  1548. Streptomyces sp. NPDC059873 tRNA-Gly
  1549. Streptomyces sp. NPDC059919 tRNA-Gly
  1550. Streptomyces sp. NPDC059990 tRNA-Gly
  1551. Streptomyces sp. STD 3.1 tRNA-Gly
  1552. Streptomyces virginiae tRNA-Gly
  1553. Sutcliffiella cohnii tRNA-Gly
  1554. Sutcliffiella halmapala tRNA-Gly
  1555. Sutcliffiella horikoshii tRNA-Gly
  1556. Sutcliffiella sp. FSL R7-0096 tRNA-Gly
  1557. Sutcliffiella sp. NC1 tRNA-Gly
  1558. Sutcliffiella sp. NPDC057660 tRNA-Gly
  1559. Tenuibacillus multivorans tRNA-Gly
  1560. Terribacillus halophilus tRNA-Gly
  1561. Terribacillus jepli Terribacillus sp. 179-K 1B1 HS tRNA-Gly
  1562. Terribacillus sp. FSL K6-0262 tRNA-Gly
  1563. Terrihalobacillus insolitus tRNA-Gly
  1564. Tetragenococcus koreensis tRNA-Gly
  1565. Thalassobacillus devorans tRNA-Gly
  1566. Thalassobacillus hwangdonensis tRNA-Gly
  1567. Thalassorhabdus alkalitolerans tRNA-Gly
  1568. Tigheibacillus halophilus tRNA-Gly
  1569. Tigheibacillus jepli tRNA-Gly
  1570. Tistrella mobilis tRNA-Gly
  1571. Geobacillus kaustophilus tRNA-Gly from Geobacillus kaustophilus (PDB 6PMO, chain B)
  1572. uncultured Bacillus sp. tRNA
  1573. uncultured Halalkalibacter sp. tRNA
  1574. uncultured Halobacillus sp. tRNA
  1575. uncultured Massilibacterium sp. tRNA
  1576. uncultured Melghiribacillus sp. tRNA
  1577. uncultured Paucisalibacillus sp. tRNA
  1578. uncultured Rossellomorea sp. tRNA
  1579. uncultured Schinkia sp. tRNA
  1580. Variovorax sp. CCNWLW225 tRNA-Gly
  1581. Veillonella sp. tRNA-Gly
  1582. Vibrio parahaemolyticus tRNA-Gly
  1583. Virgibacillus ainsalahensis tRNA-Gly
  1584. Virgibacillus alimentarius tRNA-Gly
  1585. Virgibacillus chiguensis tRNA-Gly
  1586. Virgibacillus dakarensis tRNA-Gly
  1587. Virgibacillus dokdonensis tRNA-Gly
  1588. Virgibacillus halodenitrificans tRNA-Gly
  1589. Virgibacillus halotolerans tRNA-Gly
  1590. Virgibacillus indicus tRNA-Gly
  1591. Virgibacillus salexigens tRNA-Gly
  1592. Virgibacillus kekensis tRNA-Gly
  1593. Virgibacillus kimchii tRNA-Gly
  1594. Virgibacillus litoralis tRNA-Gly
  1595. Virgibacillus salexigens tRNA-Gly
  1596. Virgibacillus natechei tRNA-Gly
  1597. Virgibacillus oceani tRNA-Gly
  1598. Virgibacillus pantothenticus tRNA-Gly
  1599. Virgibacillus profundi tRNA-Gly
  1600. Virgibacillus proomii tRNA-Gly
  1601. Virgibacillus salexigens tRNA-Gly
  1602. Virgibacillus saliphilus tRNA-Gly
  1603. Virgibacillus sediminis tRNA-Gly
  1604. Virgibacillus siamensis tRNA-Gly
  1605. Paracerasibacillus soli tRNA-Gly
  1606. Virgibacillus sp. 19R1-5 tRNA-Gly
  1607. Virgibacillus sp. 6R tRNA-Gly
  1608. Virgibacillus tibetensis Virgibacillus sp. C22-A2 tRNA-Gly
  1609. Virgibacillus sp. CBA3643 tRNA-Gly
  1610. Virgibacillus sp. CM-4 tRNA-Gly
  1611. Virgibacillus sp. tRNA-Gly
  1612. Virgibacillus sp. FSP13 tRNA-Gly
  1613. Virgibacillus sp. JSM 102003 tRNA-Gly
  1614. Virgibacillus sp. L01 tRNA-Gly
  1615. Virgibacillus sp. M23 tRNA-Gly
  1616. Virgibacillus sp. MSJ-26 tRNA-Gly
  1617. Virgibacillus sp. MSP4-1 tRNA-Gly
  1618. Virgibacillus sp. SK37 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  1619. Virgibacillus sp. W0181 tRNA-Gly
  1620. Virgibacillus sp. W0430 tRNA-Gly
  1621. Virgibacillus xinjiangensis tRNA-Gly
  1622. Weizmannia acidilactici tRNA-Gly
  1623. Yersinia enterocolitica tRNA-Gly
Relationships

Molecular Relationships

2D structure

Loading 2D structure...