Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus sp. FSL L8-0654 tRNA-Gly secondary structure diagram

Bacillus sp. FSL L8-0654 tRNA-Gly URS00005115FB_2921526

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,300 other species

  1. Abyssicoccus albus tRNA-Gly
  2. Aeribacillus composti tRNA-Gly
  3. Aeribacillus pallidus tRNA-Gly
  4. Aeribacillus sp. FSL K6-1121 tRNA-Gly
  5. Aeribacillus sp. FSL K6-1305 tRNA-Gly
  6. Aeribacillus sp. FSL k6-2211 tRNA-Gly
  7. Aeribacillus sp. FSL K6-2833 tRNA-Gly
  8. Aeribacillus sp. FSL K6-2848 tRNA-Gly
  9. Aeribacillus sp. FSL K6-3256 tRNA-Gly
  10. Aeribacillus sp. FSL K6-8210 tRNA-Gly
  11. Aeribacillus sp. FSL K6-8394 tRNA-Gly
  12. Aeribacillus sp. FSL M8-0235 tRNA-Gly
  13. Aeribacillus sp. FSL M8-0254 tRNA-Gly
  14. Aeribacillus sp. FSL W8-0870 tRNA-Gly
  15. Aliibacillus thermotolerans tRNA-Gly
  16. Aliicoccus persicus (gut metagenome) tRNA-Gly
  17. Alkalicoccobacillus gibsonii tRNA-Gly
  18. Alkalihalobacillus alcalophilus tRNA-Gly
  19. Alkalihalobacillus sp. 1P02AB tRNA-Gly
  20. Alkalihalobacillus sp. AL-G tRNA-Gly
  21. Alkalihalobacillus sp. MEB130 tRNA-Gly
  22. Allobacillus halotolerans tRNA-Gly
  23. Allobacillus sp. GCM10007489 tRNA-Gly
  24. Allobacillus sp. GCM10007490 tRNA-Gly
  25. Allobacillus sp. GCM10007491 tRNA-Gly
  26. Allobacillus sp. SKP2-8 tRNA-Gly
  27. Allobacillus salarius tRNA-Gly
  28. Allobacillus saliphilus tRNA-Gly
  29. Alteribacillus sp. JSM 102045 tRNA-Gly
  30. Amphibacillus xylanus NBRC 15112 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  31. Aneurinibacillus aneurinilyticus tRNA-Gly
  32. Aquibacillus albus tRNA-Gly
  33. Aquibacillus halophilus tRNA-Gly
  34. Aquibacillus koreensis tRNA-Gly
  35. Aquibacillus salsiterrae tRNA-Gly
  36. Bacillaceae bacterium tRNA-Gly
  37. Pradoshia eiseniae tRNA-Gly
  38. Bacillaceae bacterium HSR45 tRNA-Gly
  39. Mangrovibacillus cuniculi tRNA-Gly
  40. Bacillaceae bacterium S4-13-56 tRNA-Gly
  41. Bacillaceae bacterium S4-13-58 tRNA-Gly
  42. Bacillaceae bacterium SAOS 7 tRNA-Gly
  43. Bacillaceae bacterium SAS-127 tRNA-Gly
  44. Radiobacillus deserti tRNA-Gly
  45. Bacillales bacterium tRNA-Gly
  46. Bacilli bacterium tRNA-Gly
  47. Bacilli bacterium VT-13-104 tRNA-Gly
  48. Bacillota bacterium Lsc_1132 tRNA-Gly
  49. Bacillota bacterium tRNA-Gly
  50. Bacillus aerius tRNA-Gly
  51. Bacillus aerophilus tRNA-Gly
  52. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Gly
  53. Evansella alkalicola tRNA-Gly
  54. Bacillus altitudinis A23-8 tRNA-Gly
  55. Bacillus altitudinis MN12 tRNA-Gly
  56. Bacillus altitudinis S70-5-12 tRNA-Gly
  57. Bacillus altitudinis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  58. Aeribacillus alveayuensis tRNA-Gly
  59. Bacillus amyloliquefaciens CC178 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  60. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  61. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Gly
  62. Bacillus amyloliquefaciens IT-45 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  63. Bacillus amyloliquefaciens KHG19 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  64. Bacillus amyloliquefaciens LFB112 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  65. Bacillus amyloliquefaciens tRNA-Gly
  66. Bacillus amyloliquefaciens UASWS BA1 tRNA-Gly
  67. Bacillus amyloliquefaciens UMAF6614 tRNA-Gly
  68. Bacillus amyloliquefaciens UMAF6639 tRNA-Gly
  69. Bacillus anthracis tRNA-Gly
  70. Bacillus australimaris tRNA-Gly
  71. Schinkia azotoformans MEV2011 tRNA-Gly
  72. Pseudobacillus badius tRNA-Gly
  73. Bacillus cabrialesii subsp. cabrialesii tRNA-Gly
  74. Bacillus cabrialesii subsp. tritici tRNA-Gly
  75. Bacillus cabrialesii tRNA-Gly
  76. Heyndrickxia camelliae tRNA-Gly
  77. Bacillus carboniphilus tRNA-Gly
  78. Bacillus altitudinis tRNA-Gly
  79. Bacillus cereus tRNA-Gly
  80. Bacillus changyiensis tRNA-Gly
  81. Bacillus chungangensis tRNA-Gly
  82. Niallia circulans tRNA-Gly
  83. Bacillus coahuilensis m2-6 tRNA-Gly
  84. Bacillus coahuilensis p1.1.43 tRNA-Gly
  85. Cytobacillus dafuensis tRNA-Gly
  86. Cytobacillus depressus tRNA-Gly
  87. [Bacillus] enclensis tRNA-Gly
  88. Priestia endophytica DSM 13796 tRNA_Gly_GCC
  89. Priestia endophytica tRNA-Gly
  90. Niallia endozanthoxylica tRNA-Gly
  91. Bacillus fengqiuensis tRNA-Gly
  92. Priestia filamentosa tRNA-Gly
  93. Bacillus glycinifermentans tRNA-Gly
  94. Bacillus haikouensis tRNA-Gly
  95. Bacillus halotolerans tRNA-Gly
  96. Bacillus haynesii tRNA-Gly
  97. Bacillus inaquosorum tRNA-Gly(gcc)
  98. Metabacillus indicus LMG 22858 tRNA-Gly
  99. Priestia koreensis tRNA-Gly
  100. Halalkalibacter krulwichiae tRNA-Gly
  101. Robertmurraya kyonggiensis tRNA-Gly
  102. Lederbergia lenta tRNA-Gly(gcc)
  103. Bacillus licheniformis CG-B52 tRNA-Gly
  104. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  105. Bacillus licheniformis LMG 17339 tRNA-Gly
  106. Bacillus licheniformis tRNA-Gly
  107. Bacillus licheniformis WX-02 tRNA-Gly
  108. Bacillus lumedeiriae tRNA-Gly
  109. Rossellomorea marisflavi tRNA-Gly
  110. Priestia megaterium tRNA-Gly
  111. Neobacillus mesonae tRNA-Gly
  112. Bacillus mesophilum tRNA-Gly
  113. Bacillus mesophilus tRNA-Gly
  114. Bacillus methanolicus PB1 tRNA-Gly
  115. Bacillus methanolicus tRNA-Gly
  116. Bacillus mojavensis tRNA-Gly
  117. Alkalicoccobacillus murimartini tRNA-Gly
  118. Bacillus nakamurai tRNA-Gly
  119. Halalkalibacter nanhaiisediminis tRNA-Gly
  120. Niallia nealsonii AAU1 tRNA-Gly
  121. Neobacillus notoginsengisoli tRNA-Gly
  122. Bacillus obstructivus tRNA-Gly
  123. Halalkalibacter okhensis tRNA-Gly
  124. Halalkalibacterium halodurans tRNA-Gly
  125. Bacillus oleivorans tRNA-Gly
  126. Bacillus paralicheniformis ATCC 9945a tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  127. Bacillus paralicheniformis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  128. Bacillus paranthracis tRNA-Gly
  129. Alkalihalobacillus pseudalcaliphilus tRNA-Gly
  130. Bacillus pumilus ATCC 7061 tRNA-Gly
  131. Bacillus pumilus SAFR-032 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  132. Bacillus pumilus tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  133. Bacillus rugosus tRNA-Gly
  134. Bacillus safensis FO-36b tRNA-Gly
  135. Bacillus safensis subsp. safensis tRNA-Gly
  136. Bacillus safensis tRNA-Gly
  137. Bacillus salitolerans tRNA-Gly
  138. Bacillus seohaeanensis tRNA-Gly
  139. Bacillus shivajii tRNA-Gly
  140. Bacillus siamensis tRNA-Gly
  141. Bacillus solimangrovi tRNA-Gly
  142. Bacillus songklensis tRNA-Gly
  143. Bacillus sonorensis L12 tRNA-Gly
  144. Bacillus sonorensis tRNA-Gly
  145. Bacillus sp. 005/A4HT-01/001 tRNA-Gly
  146. Bacillus sp. 0102A tRNA-Gly
  147. Bacillus sp. 0209A tRNA-Gly
  148. Bacillus sp. 0909A tRNA-Gly
  149. Bacillus sp. 1021 tRNA-Gly
  150. Bacillus sp. 1735sda2 tRNA-Gly
  151. Bacillus sp. 179-C3.3 HS tRNA-Gly
  152. Bacillus sp. 1P02SD tRNA-Gly
  153. Bacillus sp. 1P10SD tRNA-Gly
  154. Bacillus sp. 1s-1 tRNA-Gly
  155. Bacillus sp. 2211 tRNA-Gly
  156. Bacillus sp. 275 tRNA-Gly
  157. Bacillus sp. 28A-2 tRNA-Gly
  158. Robertmurraya mangrovi Bacillus sp. 31A1R tRNA-Gly
  159. Bacillus sp. 31 tRNA-Gly
  160. Bacillus sp. 348 tRNA-Gly
  161. Bacillus sp. 349Y tRNA-Gly
  162. Bacillus sp. 3a tRNA-Gly
  163. Bacillus sp. 5001 tRNA-Gly
  164. Bacillus sp. 5B6 tRNA-Gly
  165. Bacillus sp. 7504-2 tRNA-Gly
  166. Bacillus sp. 7586-K tRNA-Gly
  167. Bacillus sp. 7788 tRNA-Gly
  168. Bacillus sp. 7884-1 tRNA-Gly
  169. Bacillus sp. 7D3 tRNA-Gly
  170. Bacillus sp. 9J tRNA-Gly
  171. Bacillus sp. A053 tRNA-Gly
  172. Bacillus sp. A1 tRNA-Gly
  173. Bacillus sp. A31 tRNA-Gly
  174. Bacillus sp. AAVF1 tRNA-Gly
  175. Bacillus sp. AFS015802 tRNA-Gly
  176. Bacillus sp. AFS037270 tRNA-Gly
  177. Bacillus sp. AFS040349 tRNA-Gly
  178. Bacillus sp. AFS073361 tRNA-Gly
  179. Bacillus sp. AFS076308 tRNA-Gly
  180. Bacillus sp. AG1 tRNA-Gly
  181. Bacillus sp. AM1(2019) tRNA-Gly
  182. Bacillus sp. AM 13(2015) tRNA-Gly
  183. Bacillus sp. AN2 tRNA-Gly
  184. Bacillus sp. ANT_WA51 tRNA-Gly
  185. Bacillus sp. APMAM tRNA-Gly
  186. Bacillus siamensis Bacillus sp. B01(2024) tRNA-Gly
  187. Bacillus sp. B1(2022) tRNA-Gly
  188. Bacillus sp. B18(2022) tRNA-Gly
  189. Bacillus sp. B19-2 tRNA-Gly
  190. Bacillus sp. B1-b2 tRNA-Gly
  191. Bacillus sp. B2(2022) tRNA-Gly
  192. Bacillus sp. B28 tRNA-Gly
  193. Bacillus sp. B6(2022) tRNA-Gly
  194. Bacillus sp. B8(2022) tRNA-Gly
  195. Bacillus sp. BAC tRNA-Gly
  196. Bacillus sp. BC1-43 tRNA-Gly
  197. Bacillus sp. BD48 tRNA-Gly
  198. Bacillus sp. BGMRC 2118 tRNA-Gly
  199. Bacillus sp. BH072 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  200. Bacillus sp. BHET2 tRNA-Gly
  201. Bacillus sp. B-jedd tRNA-Gly
  202. Bacillus sp. B.PNR1 tRNA-Gly
  203. Bacillus sp. B.PNR2 tRNA-Gly
  204. Bacillus sp. BR_10 tRNA-Gly
  205. Bacillus sp. BS1807G30 tRNA-Gly
  206. Bacillus sp. BS3(2021) tRNA-Gly
  207. Bacillus sp. BT1B_CT2 tRNA-Gly
  208. Bacillus sp. Bva_UNVM-123 tRNA-Gly
  209. Bacillus sp. C10(2022) tRNA-Gly
  210. Bacillus sp. C11(2022) tRNA-Gly
  211. Bacillus sp. C1(2022) tRNA-Gly
  212. Bacillus sp. C15(2022) tRNA-Gly
  213. Bacillus sp. C15 tRNA-Gly
  214. Bacillus sp. C2(2022) tRNA-Gly
  215. Bacillus sp. C28GYM-DRY-1 tRNA-Gly
  216. Bacillus sp. C3(2022) tRNA-Gly
  217. Bacillus sp. C37plca tRNA-Gly
  218. Bacillus sp. C5(2022) tRNA-Gly
  219. Bacillus sp. CCNWLCWHY013 tRNA-Gly
  220. Bacillus sp. CGMCC 1.16607 tRNA-Gly
  221. Bacillus sp. CH30_1T tRNA-Gly
  222. Bacillus sp. CHD6a tRNA-Gly
  223. Bacillus sp. CJCL2 tRNA-Gly
  224. Bacillus sp. cl95 tRNA_Gly_GCC
  225. Bacillus sp. CMAA 1185 tRNA-Gly
  226. Bacillus sp. CMF21 tRNA-Gly
  227. Bacillus sp. CN2 tRNA-Gly
  228. Bacillus sp. CPSM8 tRNA-Gly
  229. Bacillus aerolatus tRNA-Gly
  230. Bacillus sp. D12 tRNA-Gly
  231. Bacillus sp. DM2 tRNA-Gly
  232. Bacillus sp. DNRA2 tRNA-Gly
  233. Metabacillus sediminilitoris tRNA-Gly
  234. Bacillus sp. DSM 27956 tRNA-Gly
  235. Bacillus sp. DTU_2020_1000418_1_SI_GHA_SEK_038 tRNA-Gly
  236. Bacillus sp. EB106-08-02-XG196 tRNA-Gly
  237. Bacillus sp. EKM213B tRNA-Gly
  238. Bacillus sp. EKM417B tRNA-Gly
  239. Bacillus sp. EKM420B tRNA-Gly
  240. Bacillus sp. es.034 tRNA-Gly
  241. Bacillus sp. EU52 tRNA-Gly
  242. Bacillus sp. EU55 tRNA-Gly
  243. Bacillus sp. EU62 tRNA-Gly
  244. Bacillus sp. EU63 tRNA-Gly
  245. Bacillus sp. F19 tRNA-Gly
  246. Bacillus sp. FCW2 tRNA-Gly
  247. Bacillus sp. FJAT-14266 tRNA-Gly
  248. Bacillus sp. FJAT-18017 tRNA-Gly
  249. Bacillus sp. FJAT-21945 tRNA-Gly
  250. Bacillus sp. FJAT-21955 tRNA-Gly
  251. Bacillus sp. FJAT-27225 tRNA-Gly
  252. Bacillus sp. FJAT-27231 tRNA-Gly
  253. Bacillus sp. FJAT-27445 tRNA-Gly
  254. Bacillus sp. FJAT-27916 tRNA-Gly
  255. Bacillus sp. FJAT-27986 tRNA-Gly
  256. Bacillus sp. FJAT-29953 tRNA-Gly
  257. Bacillus sp. FJAT-42376 tRNA-Gly
  258. Lederbergia citrea tRNA-Gly
  259. Bacillus sp. FJAT-49711 tRNA-Gly
  260. Lederbergia citrea tRNA-Gly
  261. Bacillus sp. FJAT-49736 tRNA-Gly
  262. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Gly
  263. Bacillus sp. FJAT-53060 tRNA-Gly
  264. Bacillus sp. FMQ74 tRNA-Gly
  265. Bacillus sp. FSL E2-0174 tRNA-Gly
  266. Bacillus sp. FSL H7-0578 tRNA-Gly
  267. Bacillus sp. FSL H8-0512 tRNA-Gly
  268. Bacillus sp. FSL H8-0515 tRNA-Gly
  269. Bacillus sp. FSL H8-0516 tRNA-Gly
  270. Bacillus sp. FSL H8-0547 tRNA-Gly
  271. Bacillus sp. FSL K6-0036 tRNA-Gly
  272. Bacillus sp. FSL K6-0046 tRNA-Gly
  273. Bacillus sp. FSL K6-0138 tRNA-Gly
  274. Bacillus sp. FSL K6-0250 tRNA-Gly
  275. Bacillus sp. FSL K6-0255 tRNA-Gly
  276. Bacillus sp. FSL K6-0764 tRNA-Gly
  277. Bacillus sp. FSL K6-0923 tRNA-Gly
  278. Bacillus sp. FSL K6-0947 tRNA-Gly
  279. Bacillus sp. FSL K6-0972 tRNA-Gly
  280. Bacillus sp. FSL K6-0993 tRNA-Gly
  281. Bacillus sp. FSL K6-0994 tRNA-Gly
  282. Bacillus sp. FSL K6-0998 tRNA-Gly
  283. Bacillus sp. FSL K6-1000 tRNA-Gly
  284. Bacillus sp. FSL K6-1003 tRNA-Gly
  285. Bacillus sp. FSL K6-1005 tRNA-Gly
  286. Bacillus sp. FSL K6-1006 tRNA-Gly
  287. Bacillus sp. FSL K6-1012 tRNA-Gly
  288. Bacillus sp. FSL K6-1033 tRNA-Gly
  289. Bacillus sp. FSL K6-1106 tRNA-Gly
  290. Bacillus sp. FSL K6-1109 tRNA-Gly
  291. Bacillus sp. FSL K6-1145 tRNA-Gly
  292. Bacillus sp. FSL K6-1234 tRNA-Gly
  293. Bacillus sp. FSL K6-1284 tRNA-Gly
  294. Bacillus sp. FSL K6-1336 tRNA-Gly
  295. Bacillus sp. FSL K6-1366 tRNA-Gly
  296. Bacillus sp. FSL K6-1560 tRNA-Gly
  297. Bacillus sp. FSL K6-2431 tRNA-Gly
  298. Bacillus sp. FSL K6-2819 tRNA-Gly
  299. Bacillus sp. FSL K6-2837 tRNA-Gly
  300. Bacillus sp. FSL K6-2839 tRNA-Gly
  301. Bacillus sp. FSL K6-2841 tRNA-Gly
  302. Bacillus sp. FSL K6-2860 tRNA-Gly
  303. Bacillus sp. FSL K6-2861 tRNA-Gly
  304. Bacillus sp. FSL K6-2865 tRNA-Gly
  305. Bacillus sp. FSL K6-2869 tRNA-Gly
  306. Bacillus sp. FSL K6-2971 tRNA-Gly
  307. Bacillus sp. FSL K6-3149 tRNA-Gly
  308. Bacillus sp. FSL K6-3154 tRNA-Gly
  309. Bacillus sp. FSL K6-3176 tRNA-Gly
  310. Bacillus sp. FSL K6-3200 tRNA-Gly
  311. Bacillus sp. FSL K6-3221 tRNA-Gly
  312. Bacillus sp. FSL K6-3312 tRNA-Gly
  313. Bacillus sp. FSL K6-3458 tRNA-Gly
  314. Bacillus sp. FSL K6-3459 tRNA-Gly
  315. Bacillus sp. FSL K6-3846 tRNA-Gly
  316. Bacillus sp. FSL K6-4563 tRNA-Gly
  317. Bacillus sp. FSL K6-5915 tRNA-Gly
  318. Bacillus sp. FSL K6-6540 tRNA-Gly
  319. Bacillus sp. FSL K6-8391 tRNA-Gly
  320. Bacillus sp. FSL L8-0167 tRNA-Gly
  321. Bacillus sp. FSL L8-0173 tRNA-Gly
  322. Bacillus sp. FSL L8-0186 tRNA-Gly
  323. Bacillus sp. FSL L8-0193 tRNA-Gly
  324. Bacillus sp. FSL L8-0215 tRNA-Gly
  325. Bacillus sp. FSL L8-0222 tRNA-Gly
  326. Bacillus sp. FSL L8-0358 tRNA-Gly
  327. Bacillus sp. FSL L8-0528 tRNA-Gly
  328. Bacillus sp. FSL L8-0533 tRNA-Gly
  329. Bacillus sp. FSL L8-0661 tRNA-Gly
  330. Bacillus sp. FSL M7-0003 tRNA-Gly
  331. Bacillus sp. FSL M7-0307 tRNA-Gly
  332. Bacillus sp. FSL M7-0417 tRNA-Gly
  333. Bacillus sp. FSL M7-0558 tRNA-Gly
  334. Bacillus sp. FSL M7-0791 tRNA-Gly
  335. Bacillus sp. FSL M7-1004 tRNA-Gly
  336. Bacillus sp. FSL M8-0025 tRNA-Gly
  337. Bacillus sp. FSL M8-0049 tRNA-Gly
  338. Bacillus sp. FSL M8-0052 tRNA-Gly
  339. Bacillus sp. FSL M8-0054 tRNA-Gly
  340. Bacillus sp. FSL M8-0071 tRNA-Gly
  341. Bacillus sp. FSL M8-0077 tRNA-Gly
  342. Bacillus sp. FSL M8-0133 tRNA-Gly
  343. Bacillus sp. FSL M8-0166 tRNA-Gly
  344. Bacillus sp. FSL M8-0168 tRNA-Gly
  345. Bacillus sp. FSL M8-0256 tRNA-Gly
  346. Bacillus sp. FSL M8-0266 tRNA-Gly
  347. Bacillus sp. FSL M8-0277 tRNA-Gly
  348. Bacillus sp. FSL M8-0315 tRNA-Gly
  349. Bacillus sp. FSL M8-0326 tRNA-Gly
  350. Bacillus sp. FSL M8-0350 tRNA-Gly
  351. Bacillus sp. FSL M8-0359 tRNA-Gly
  352. Bacillus sp. FSL P2-0026 tRNA-Gly
  353. Bacillus sp. FSL P2-0069 tRNA-Gly
  354. Bacillus sp. FSL P2-0092 tRNA-Gly
  355. Bacillus sp. FSL P4-0248 tRNA-Gly
  356. Bacillus sp. FSL P4-0290 tRNA-Gly
  357. Bacillus sp. FSL P4-0322 tRNA-Gly
  358. Bacillus sp. FSL P4-0334 tRNA-Gly
  359. Bacillus sp. FSL R5-0286 tRNA-Gly
  360. Bacillus sp. FSL R5-0293 tRNA-Gly
  361. Bacillus sp. FSL R5-0397 tRNA-Gly
  362. Bacillus sp. FSL R5-0416 tRNA-Gly
  363. Bacillus sp. FSL R5-0418 tRNA-Gly
  364. Bacillus sp. FSL R5-0422 tRNA-Gly
  365. Bacillus sp. FSL R5-0431 tRNA-Gly
  366. Bacillus sp. FSL R5-0432 tRNA-Gly
  367. Bacillus sp. FSL R5-0434 tRNA-Gly
  368. Bacillus sp. FSL R5-0439 tRNA-Gly
  369. Bacillus sp. FSL R5-0443 tRNA-Gly
  370. Bacillus sp. FSL R5-0447 tRNA-Gly
  371. Bacillus sp. FSL R5-0512 tRNA-Gly
  372. Bacillus sp. FSL R5-0523 tRNA-Gly
  373. Bacillus sp. FSL R5-0560 tRNA-Gly
  374. Bacillus sp. FSL R5-0576 tRNA-Gly
  375. Bacillus sp. FSL R5-0586 tRNA-Gly
  376. Bacillus sp. FSL R5-0593 tRNA-Gly
  377. Bacillus sp. FSL R5-0603 tRNA-Gly
  378. Bacillus sp. FSL R5-0654 tRNA-Gly
  379. Bacillus sp. FSL R5-0659 tRNA-Gly
  380. Bacillus sp. FSL R5-0712 tRNA-Gly
  381. Bacillus sp. FSL R5-0820 tRNA-Gly
  382. Bacillus sp. FSL R7-0166 tRNA-Gly
  383. Bacillus sp. FSL R7-0229 tRNA-Gly
  384. Bacillus sp. FSL R7-0646 tRNA-Gly
  385. Bacillus sp. FSL R7-0651 tRNA-Gly
  386. Bacillus sp. FSL R7-0672 tRNA-Gly
  387. Bacillus sp. FSL R7-0675 tRNA-Gly
  388. Bacillus sp. FSL R7-0685 tRNA-Gly
  389. Bacillus sp. FSL R7-0718 tRNA-Gly
  390. Bacillus sp. FSL W7-1034 tRNA-Gly
  391. Bacillus sp. FSL W7-1085 tRNA-Gly
  392. Bacillus sp. FSL W7-1092 tRNA-Gly
  393. Bacillus sp. FSL W7-1336 tRNA-Gly
  394. Bacillus sp. FSL W7-1346 tRNA-Gly
  395. Bacillus sp. FSL W7-1354 tRNA-Gly
  396. Bacillus sp. FSL W7-1582 tRNA-Gly
  397. Bacillus sp. FSL W8-0006 tRNA-Gly
  398. Bacillus sp. FSL W8-0183 tRNA-Gly
  399. Bacillus sp. FSL W8-0445 tRNA-Gly
  400. Bacillus sp. FSL W8-0502 tRNA-Gly
  401. Bacillus sp. FSL W8-0629 tRNA-Gly
  402. Bacillus sp. FSL W8-0645 tRNA-Gly
  403. Bacillus sp. FSL W8-0672 tRNA-Gly
  404. Bacillus sp. FSL W8-0812 tRNA-Gly
  405. Bacillus sp. FSL W8-0848 tRNA-Gly
  406. Bacillus sp. FSL W8-0920 tRNA-Gly
  407. Bacillus sp. FSL W8-0940 tRNA-Gly
  408. Bacillus sp. FSL W8-1141 tRNA-Gly
  409. Bacillus sp. FSL W8-1143 tRNA-Gly
  410. Bacillus sp. FSL W8-1202 tRNA-Gly
  411. Bacillus sp. FW1 tRNA-Gly
  412. Bacillus sp. G1(2015b) tRNA-Gly
  413. Bacillus sp. GBSC66 tRNA-Gly
  414. Bacillus sp. GBSW19 tRNA-Gly
  415. Bacillus sp. GBSW2 tRNA-Gly
  416. Bacillus sp. Gen2 tRNA-Gly
  417. Bacillus sp. Gen3 tRNA-Gly
  418. Bacillus sp. GZB tRNA-Gly
  419. Bacillus sp. H15-1 tRNA-Gly
  420. Exobacillus caeni tRNA-Gly
  421. Litchfieldia suaedae tRNA-Gly
  422. Bacillus sp. HMF5848 tRNA-Gly
  423. Bacillus sp. HMG tRNA-Gly
  424. Bacillus sp. HMSC76G11 tRNA-Gly
  425. Bacillus sp. HNA3 tRNA-Gly
  426. Bacillus sp. HNG tRNA-Gly
  427. Bacillus sp. HSf4 tRNA-Gly
  428. Bacillus sp. I-2 tRNA-Gly
  429. Metabacillus arenae tRNA-Gly
  430. Bacillus sp. ICE1 tRNA-Gly
  431. Bacillus sp. IG2 tRNA-Gly
  432. Bacillus sp. IG6 tRNA-Gly
  433. Bacillus sp. (in: firmicutes) (in: firmicutes) tRNA-Gly
  434. Bacillus sp. IS1 tRNA-Gly
  435. Bacillus sp. ISL-18 tRNA-Gly
  436. Bacillus sp. ISL-26 tRNA-Gly
  437. Bacillus sp. IT-13CA1 tRNA-Gly
  438. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Gly
  439. Bacillus spizizenii str. W23 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  440. Bacillus spizizenii tRNA-Gly(gcc)
  441. Bacillus spizizenii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  442. Bacillus spizizenii TU-B-10 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  443. Bacillus sp. J41TS8 tRNA-Gly
  444. Bacillus sp. J5TS4 tRNA-Gly
  445. Bacillus sp. JHAA tRNA-Gly
  446. Sutcliffiella rhizosphaerae tRNA-Gly
  447. Bacillus sp. JJ1474 tRNA-Gly
  448. Bacillus sp. JJ1521 tRNA-Gly
  449. Bacillus sp. JJ1532 tRNA-Gly
  450. Bacillus sp. JJ1533 tRNA-Gly
  451. Bacillus sp. JJ1562 tRNA-Gly
  452. Bacillus sp. JJ1566 tRNA-Gly
  453. Bacillus sp. JJ1764 tRNA-Gly
  454. Bacillus sp. JJ1773 tRNA-Gly
  455. Bacillus sp. JJ353 tRNA-Gly
  456. Bacillus sp. JJ675 tRNA-Gly
  457. Bacillus sp. JNUCC-21 tRNA-Gly
  458. Bacillus sp. JNUCC-22 tRNA-Gly
  459. Bacillus sp. JNUCC-24 tRNA-Gly
  460. Bacillus sp. JRC01 tRNA-Gly
  461. Bacillus sp. JS tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  462. Bacillus sp. KBS0812 tRNA-Gly
  463. Bacillus sp. KH172YL63 tRNA-Gly
  464. Bacillus sp. KICET-1 tRNA-Gly
  465. Bacillus sp. KICET-3 tRNA-Gly
  466. Bacillus sp. L_1B0_12 tRNA-Gly
  467. Bacillus sp. L381 tRNA-Gly
  468. Bacillus sp. LB7 tRNA-Gly
  469. Bacillus sp. Leaf406 tRNA-Gly
  470. Bacillus sp. Leaf49 tRNA-Gly
  471. Neobacillus massiliamazoniensis tRNA-Gly
  472. Bacillus sp. LJBS06 tRNA-Gly
  473. Bacillus sp. LJBS17 tRNA-Gly
  474. Bacillus sp. LJBV19 tRNA-Gly
  475. Bacillus sp. LK10 tRNA-Gly
  476. Bacillus sp. LK7 tRNA-Gly
  477. Bacillus sp. LL01 tRNA-Gly
  478. Bacillus sp. LLTC93 tRNA-Gly
  479. Bacillus sp. LM 4-2 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  480. Bacillus sp. LMB3902 tRNA-Gly
  481. Bacillus sp. LNXM10 tRNA-Gly
  482. Bacillus sp. LNXM12-1 tRNA-Gly
  483. Bacillus sp. LNXM12-2 tRNA-Gly
  484. Bacillus sp. LNXM65 tRNA-Gly
  485. Bacillus sp. LR_6 tRNA-Gly
  486. Bacillus sp. LUNF1 tRNA-Gly
  487. Bacillus sp. LYLB4 tRNA-Gly
  488. Bacillus velezensis tRNA-Gly
  489. Bacillus sp. M 2-6 tRNA-Gly
  490. Bacillus sp. MAG717A tRNA-Gly
  491. Bacillus sp. Man122 tRNA-Gly
  492. Bacillus sp. MBGLi79 tRNA-Gly
  493. Bacillus sp. MBGLi97 tRNA-Gly
  494. Bacillus sp. MD-5 tRNA-Gly
  495. Bacillus sp. MKU004 tRNA-Gly
  496. Bacillus sp. MRMR6 tRNA-Gly
  497. Bacillus sp. ms-22 tRNA-Gly
  498. Bacillus sp. MT(2024) tRNA-Gly
  499. Bacillus sp. MT tRNA-Gly
  500. Bacillus sp. MUM 116 tRNA-Gly
  501. Bacillus sp. MZGC1 tRNA-Gly
  502. Bacillus sp. N12A5 tRNA-Gly
  503. Bacillus sp. N13C7 tRNA-Gly
  504. Bacillus sp. N9 tRNA-Gly
  505. Bacillus sp. NEAU-16 tRNA-Gly
  506. Bacillus sp. NEAU-242-2 tRNA-Gly
  507. Bacillus sp. NIO_002 tRNA-Gly
  508. Bacillus sp. NMCC46 tRNA-Gly
  509. Bacillus sp. NMCC4 tRNA-Gly
  510. Bacillus sp. NMCN1 tRNA-Gly
  511. Bacillus sp. NMCN6 tRNA-Gly
  512. Bacillus sp. NMTD17 tRNA-Gly
  513. Bacillus sp. NPDC093026 tRNA-Gly
  514. Bacillus sp. NSP9.1 tRNA-Gly
  515. Bacillus sp. NTK074B tRNA-Gly
  516. Bacillus sp. OAE578 tRNA-Gly
  517. Bacillus spongiae tRNA-Gly
  518. Bacillus sp. OVS6 tRNA-Gly
  519. Bacillus sp. P003 tRNA-Gly
  520. Bacillus sp. PAMC22265 tRNA-Gly
  521. Bacillus sp. PAMC26543 tRNA-Gly
  522. Bacillus sp. PAMC26568 tRNA-Gly
  523. Bacillus sp. PAMC28571 tRNA-Gly
  524. Bacillus sp. PAMC28748 tRNA-Gly
  525. Bacillus sp. Pc3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  526. Bacillus sp. PDNC022 tRNA-Gly
  527. Bacillus sp. PK3_68 tRNA-Gly
  528. Bacillus sp. PM8313 tRNA-Gly
  529. Bacillus sp. PS06 tRNA-Gly
  530. Bacillus sp. PS108 tRNA-Gly
  531. Bacillus sp. PS11(2022) tRNA-Gly
  532. Bacillus sp. PS18 tRNA-Gly
  533. Bacillus sp. PS194 tRNA-Gly
  534. Bacillus sp. PS196 tRNA-Gly
  535. Bacillus sp. PS20 tRNA-Gly
  536. Bacillus sp. PS210 tRNA-Gly
  537. Bacillus sp. PS217 tRNA-Gly
  538. Bacillus sp. PS237 tRNA-Gly
  539. Bacillus sp. PS65 tRNA-Gly
  540. Bacillus sp. PS68 tRNA-Gly
  541. Bacillus sp. PS93 tRNA-Gly
  542. Bacillus sp. PS95 tRNA-Gly
  543. Bacillus sp. PsM16 tRNA-Gly
  544. Bacillus sp. PW192 tRNA-Gly
  545. Bacillus sp. R45 tRNA-Gly
  546. Bacillus sp. Rc4 tRNA-Gly
  547. Bacillus sp. RHF6 tRNA-Gly
  548. Bacillus sp. RHFS10 tRNA-Gly
  549. Bacillus ayatagriensis Bacillus sp. RMG-6 tRNA-Gly
  550. Bacillus sp. RO1 tRNA-Gly
  551. Bacillus sp. Root920 tRNA-Gly
  552. Bacillus sp. RP12 tRNA-Gly
  553. Bacillus sp. Ru63 tRNA-Gly
  554. Bacillus sp. S10C12M tRNA-Gly
  555. Bacillus sp. S17B2 tRNA-Gly
  556. Bacillus sp. S20C3 tRNA-Gly
  557. Bacillus sp. S2(2019) tRNA-Gly
  558. Bacillus sp. S3 tRNA-Gly
  559. Bacillus sp. SA1-12 tRNA-Gly
  560. Bacillus sp. SAJ1 tRNA-Gly
  561. Bacillus sp. SB49 tRNA-Gly
  562. Nanhaiella sioensis Bacillus sp. SCS-151 tRNA-Gly
  563. Rossellomorea sedimentorum Bacillus sp. SCS-153A tRNA-Gly
  564. Bacillus safensis tRNA-Gly
  565. Bacillus sp. SDLI1 tRNA-Gly
  566. Bacillus sp. SG20001 tRNA-Gly
  567. Bacillus sp. SG20032 tRNA-Gly
  568. Bacillus sp. SG20033 tRNA-Gly
  569. Bacillus sp. sid0103 tRNA-Gly
  570. Bacillus sp. SIMBA_005 tRNA-Gly
  571. Bacillus sp. SIMBA_006 tRNA-Gly
  572. Bacillus sp. SIMBA_008 tRNA-Gly
  573. Bacillus sp. SIMBA_026 tRNA-Gly
  574. Bacillus sp. SIMBA_031 tRNA-Gly
  575. Bacillus sp. SIMBA_033 tRNA-Gly
  576. Bacillus sp. SIMBA_154 tRNA-Gly
  577. Bacillus sp. SIMBA_161 tRNA-Gly
  578. Bacillus sp. SJS tRNA-Gly
  579. Bacillus sp. SKDU12 tRNA-Gly
  580. Bacillus salacetis tRNA-Gly
  581. Bacillus sp. SL112 tRNA-Gly
  582. Bacillus sp. SLBN-46 tRNA-Gly
  583. Bacillus sp. SN1 tRNA-Gly
  584. Bacillus sp. SN32 tRNA-Gly
  585. Bacillus sp. SORGH_AS_0510 tRNA-Gly
  586. Paenibacillus sp. PL91 tRNA-Gly
  587. Bacillus paralicheniformis tRNA-Gly
  588. Bacillus sp. SW14 tRNA-Gly
  589. Bacillus sp. T17B1 tRNA-Gly
  590. Bacillus sp. T2.9-1 tRNA-Gly(gcc)
  591. Bacillus sp. T9C1 tRNA-Gly
  592. Bacillus sp. TBS-096 tRNA-Gly
  593. Bacillus sp. THAF10 tRNA-Gly
  594. Bacillus sp. TS-2 tRNA-Gly
  595. Bacillus sp. TSA-4 tRNA-Gly
  596. Bacillus sp. UMB0893 tRNA-Gly
  597. Bacillus sp. UMB0899 tRNA-Gly
  598. Bacillus sp. UNCCL13 tRNA_Gly_GCC
  599. Niallia alba tRNA-Gly
  600. Bacillus sp. V26 tRNA-Gly
  601. Bacillus sp. V2I10 tRNA-Gly
  602. Bacillus sp. V3 tRNA-Gly
  603. Bacillus salipaludis tRNA-Gly
  604. Bacillus sp. WP8 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  605. Bacillus sp. WR11 tRNA-Gly
  606. Bacillus sp. WR12 tRNA-Gly
  607. Bacillus sp. WR13 tRNA-Gly
  608. Bacillus sp. X1(2014) (2014) tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  609. Bacillus sp. X2(2017) tRNA-Gly
  610. Bacillus yapensis tRNA-Gly
  611. Bacillus sp. XZ-5 tRNA-Gly
  612. Bacillus sp. Y1 tRNA-Gly
  613. Bacillus sp. Y3 tRNA-Gly
  614. Bacillus sp. YBsi01 tRNA-Gly
  615. Bacillus sp. YBWC18 tRNA-Gly
  616. Bacillus sp. YC2 tRNA-Gly
  617. Bacillus sp. YP1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  618. Alteribacter lacisalsi tRNA-Gly
  619. Bacillus sp. z60-10 tRNA-Gly
  620. Bacillus sp. z60-11 tRNA-Gly
  621. Bacillus sp. z60-18 tRNA-Gly
  622. Bacillus sp. ZCB01 tRNA-Gly
  623. Bacillus sp. ZHX3 tRNA-Gly
  624. Bacillus sp. ZY-1-1 tRNA-Gly
  625. Bacillus stercoris tRNA-Gly
  626. Bacillus stratosphericus tRNA-Gly
  627. Bacillus suaedaesalsae tRNA-Gly
  628. Bacillus subtilis BEST7003 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  629. Bacillus subtilis BEST7613 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  630. Bacillus subtilis BSn5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  631. Bacillus subtilis E1 tRNA-Gly-GCC
  632. Bacillus subtilis HJ5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  633. Bacillus subtilis J22 tRNA-Gly
  634. Bacillus subtilis J23 tRNA-Gly
  635. Bacillus subtilis J24 tRNA-Gly
  636. Bacillus subtilis J25 tRNA-Gly
  637. Bacillus subtilis J26 tRNA-Gly
  638. Bacillus subtilis J27 tRNA-Gly
  639. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  640. Bacillus subtilis MB73/2 tRNA-Gly
  641. Bacillus subtilis PY79 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  642. Bacillus subtilis QB928 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  643. Bacillus subtilis QH-1 tRNA-Gly
  644. Bacillus inaquosorum KCTC 13429 tRNA-Gly
  645. Bacillus subtilis subsp. natto BEST195 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  646. Bacillus subtilis subsp. natto tRNA-Gly
  647. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  648. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Gly
  649. Bacillus subtilis subsp. subtilis str. 168 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  650. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  651. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  652. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  653. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  654. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  655. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  656. Bacillus subtilis subsp. subtilis str. SC-8 tRNA-Gly
  657. Bacillus subtilis subsp. subtilis str. SMY tRNA-Gly
  658. Bacillus subtilis subsp. subtilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  659. Bacillus subtilis TO-A tRNA-Gly
  660. Bacillus subtilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  661. Bacillus subtilis XF-1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  662. Bacillus swezeyi tRNA-Gly
  663. Bacillus taeanensis tRNA-Gly
  664. Evansella tamaricis tRNA-Gly
  665. Bacillus tequilensis tRNA-Gly(gcc)
  666. Sutcliffiella tianshenii tRNA-Gly
  667. Bacillus timonensis tRNA-Gly
  668. Alkalihalobacillus trypoxylicola tRNA-Gly
  669. Bacillus vallismortis tRNA-Gly
  670. Bacillus velezensis AS43.3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  671. Bacillus velezensis CAU B946 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  672. Bacillus velezensis FZB42 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  673. Bacillus velezensis NAU-B3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  674. Bacillus velezensis NJN-6 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  675. Bacillus velezensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  676. Bacillus velezensis UCMB5033 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  677. Bacillus velezensis UCMB5036 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  678. Bacillus velezensis UCMB5113 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  679. Bacillus velezensis YAU B9601-Y2 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  680. Rossellomorea vietnamensis tRNA-Gly
  681. Heyndrickxia vini tRNA-Gly
  682. Bacillus weihaiensis tRNA-Gly
  683. Pseudobacillus wudalianchiensis tRNA-Gly
  684. Bacillus xiamenensis tRNA-Gly
  685. Bacillus xiapuensis tRNA-Gly
  686. Bacillus zhangzhouensis tRNA-Gly
  687. bacterium 1XD42-44 tRNA-Gly
  688. Bradyrhizobium sp. tRNA-Gly
  689. Peribacillus frigoritolerans tRNA-Gly
  690. Caldibacillus thermoamylovorans tRNA-Gly
  691. Caldifermentibacillus hisashii tRNA-Gly
  692. Campylobacter jejuni tRNA-Gly
  693. Chungangia koreensis tRNA-Gly
  694. Citrobacter freundii tRNA-Gly
  695. Clavibacter michiganensis tRNA-Gly
  696. Clostridium sp. 1xD42-85 tRNA-Gly
  697. Corynebacterium diphtheriae tRNA-Gly
  698. Cutibacterium acnes tRNA-Gly
  699. Cyanobacterium aponinum 0216 tRNA-Gly
  700. Cytobacillus citreus tRNA-Gly
  701. Cytobacillus eiseniae tRNA-Gly
  702. Cytobacillus gottheilii tRNA-Gly
  703. Litchfieldia luteola tRNA-Gly
  704. Cytobacillus praedii tRNA-Gly
  705. Cytobacillus solani tRNA-Gly
  706. Cytobacillus mangrovibacter Cytobacillus sp. FJAT-53684 tRNA-Gly
  707. Cytobacillus sp. IB215316 tRNA-Gly
  708. Cytobacillus sp. IB215665 tRNA-Gly
  709. Cytobacillus spongiae tRNA-Gly
  710. Embleya sp. NPDC056575 tRNA-Gly
  711. Enterococcus faecalis tRNA-Gly
  712. Enterococcus faecium tRNA-Gly
  713. Escherichia coli tRNA-Gly
  714. Falsibacillus albus tRNA-Gly
  715. Filobacillus milosensis tRNA-Gly
  716. Flavisolibacter sp. tRNA-Gly
  717. Fredinandcohnia humi tRNA-Gly
  718. Fredinandcohnia quinoae tRNA-Gly
  719. Fredinandcohnia salidurans tRNA-Gly
  720. Fredinandcohnia sp. 179-A 10B2 NHS tRNA-Gly
  721. Fredinandcohnia sp. FSL W7-1320 tRNA-Gly
  722. Fredinandcohnia sp. QZ13 tRNA-Gly
  723. Gracilibacillus halotolerans tRNA-Gly
  724. Gracilibacillus marinus tRNA-Gly
  725. Gracilibacillus salinarum tRNA-Gly
  726. Gracilibacillus caseinilyticus tRNA-Gly
  727. Gracilibacillus oryzae tRNA-Gly
  728. Gracilibacillus thailandensis tRNA-Gly
  729. Gracilibacillus ureilyticus tRNA_Gly_GCC
  730. Gracilibacillus xinjiangensis tRNA-Gly
  731. Halalkalibacter alkaliphilus tRNA-Gly
  732. Halalkalibacterium halodurans C-125 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  733. Halalkalibacterium halodurans tRNA-Gly
  734. Halalkalibacter oceani tRNA-Gly
  735. Halobacillus andaensis tRNA-Gly
  736. Halobacillus campisalis tRNA-Gly
  737. Halobacillus dabanensis tRNA_Gly_GCC
  738. Halobacillus halophilus DSM 2266 tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  739. Halobacillus halophilus tRNA-Gly
  740. Halobacillus karajensis tRNA-Gly
  741. Halobacillus litoralis tRNA-Gly
  742. Halobacillus mangrovi tRNA-Gly
  743. Halobacillus naozhouensis tRNA-Gly
  744. Halobacillus salinus tRNA-Gly
  745. Halobacillus seohaensis tRNA-Gly
  746. Halobacillus sp. A5 tRNA-Gly
  747. Halobacillus sp. ACCC02827 tRNA-Gly
  748. Halobacillus sp. BBL2006 tRNA-Gly
  749. Halobacillus sp. GSS1 tRNA-Gly
  750. Halobacillus sp. HZG1 tRNA-Gly
  751. Halobacillus yeomjeoni tRNA-Gly
  752. Halobacillus sp. MO56 tRNA-Gly
  753. Halobacillus fulvus tRNA-Gly
  754. Halobacillus salinarum tRNA-Gly
  755. Halobacillus amylolyticus tRNA-Gly
  756. Halobacillus shinanisalinarum tRNA-Gly
  757. Halobacillus sp. SY10 tRNA-Gly
  758. Halobacillus trueperi tRNA-Gly
  759. Halobacillus yeomjeoni tRNA-Gly
  760. Heyndrickxia acidicola tRNA-Gly
  761. Heyndrickxia ginsengihumi tRNA-Gly
  762. Heyndrickxia oleronia tRNA-Gly
  763. Heyndrickxia shackletonii tRNA-Gly
  764. Heyndrickxia sp. FSL K6-6286 tRNA-Gly
  765. Heyndrickxia sp. FSL W8-0423 tRNA-Gly
  766. Heyndrickxia sp. FSL W8-0496 tRNA-Gly
  767. Heyndrickxia sporothermodurans tRNA-Gly
  768. Isoptericola sp. NPDC056573 tRNA-Gly
  769. Jeotgalicoccus coquinae tRNA-Gly
  770. Phocicoccus pinnipedialis tRNA-Gly
  771. Phocicoccus schoeneichii tRNA-Gly
  772. Jeotgalicoccus meleagridis tRNA-Gly
  773. Jeotgalicoccus sp. tRNA-Gly
  774. Kitasatospora cineracea tRNA-Gly
  775. Kitasatospora sp. NPDC056184 tRNA-Gly
  776. Kitasatospora sp. NPDC058162 tRNA-Gly
  777. Klebsiella pneumoniae tRNA-Gly
  778. Klebsiella quasipneumoniae tRNA-Gly
  779. Lentilactobacillus parakefiri tRNA-Gly
  780. Lederbergia citrea tRNA-Gly
  781. Lederbergia citrisecunda tRNA-Gly
  782. Lederbergia citri tRNA-Gly
  783. Lederbergia galactosidilytica tRNA-Gly
  784. Lederbergia graminis tRNA-Gly
  785. Lederbergia wuyishanensis tRNA-Gly
  786. Leeuwenhoekiella sp. tRNA-Gly
  787. Lentibacillus amyloliquefaciens tRNA-Gly
  788. Lentibacillus halophilus tRNA-Gly
  789. Lentibacillus juripiscarius tRNA-Gly
  790. Lentibacillus kapialis tRNA-Gly
  791. Lentibacillus populi tRNA-Gly
  792. Lentibacillus sp. CBA3610 tRNA-Gly
  793. Lentibacillus sp. JNUCC-1 tRNA-Gly
  794. Lentibacillus sp. L22 tRNA-Gly
  795. Lentibacillus sp. N15 tRNA-Gly
  796. Lentibacillus cibarius tRNA-Gly
  797. Lentibacillus cibarius tRNA-Gly
  798. Lentibacillus lipolyticus tRNA-Gly
  799. Ligilactobacillus ruminis tRNA-Gly
  800. Listeria monocytogenes tRNA-Gly
  801. Litchfieldia salsa tRNA-Gly
  802. Lysinibacillus sphaericus tRNA-Gly
  803. Mangrovibacillus sp. Mu-81 tRNA-Gly
  804. Margalitia sp. FSL K6-0131 tRNA-Gly
  805. Marinococcus halophilus tRNA-Gly
  806. Marinococcus luteus tRNA-Gly
  807. Marinococcus sp. PL1-022 tRNA-Gly
  808. Marinomonas profundimaris tRNA-Gly
  809. Massilibacterium sp. tRNA-Gly
  810. Metabacillus bambusae tRNA-Gly
  811. Metabacillus dongyingensis tRNA-Gly
  812. Metabacillus endolithicus tRNA-Gly
  813. Metabacillus fastidiosus tRNA-Gly
  814. Metabacillus halosaccharovorans tRNA-Gly
  815. Metabacillus idriensis tRNA-Gly
  816. Metabacillus indicus tRNA-Gly
  817. Priestia iocasae Metabacillus iocasae tRNA-Gly
  818. Metabacillus lacus tRNA-Gly
  819. Metabacillus litoralis tRNA-Gly
  820. Metabacillus malikii tRNA-Gly
  821. Metabacillus mangrovi tRNA-Gly
  822. Metabacillus niabensis tRNA-Gly
  823. Metabacillus rhizolycopersici tRNA-Gly
  824. Metabacillus sp. B2-18 tRNA-Gly
  825. Metabacillus hrfriensis tRNA-Gly
  826. Metabacillus sediminis Metabacillus sp. FJAT-52054 tRNA-Gly
  827. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Gly
  828. Metabacillus sp. JX24 tRNA-Gly
  829. Metabacillus flavus tRNA-Gly
  830. Metabacillus elymi tRNA-Gly
  831. Metabacillus sp. tRNA-Gly
  832. Micrococcus luteus tRNA-Gly
  833. Micromonospora chalcea tRNA-Gly
  834. Micromonospora sp. 1209 tRNA-Gly
  835. Mycobacteroides abscessus subsp. abscessus tRNA-Gly(gcc)
  836. Mycobacteroides abscessus subsp. massiliense tRNA-Gly(gcc)
  837. Negativibacillus sp. 1xD8-3 tRNA-Gly
  838. Neisseria gonorrhoeae tRNA-Gly
  839. Neobacillus citreus tRNA-Gly
  840. Neobacillus cucumis tRNA-Gly
  841. Neobacillus drentensis tRNA-Gly
  842. Neobacillus driksii tRNA-Gly
  843. Neobacillus ginsengisoli tRNA-Gly
  844. Neobacillus kokaensis tRNA-Gly
  845. Neobacillus niacini tRNA-Gly
  846. Neobacillus novalis tRNA-Gly
  847. Neobacillus paridis tRNA-Gly
  848. Neobacillus pocheonensis tRNA-Gly
  849. Neobacillus rhizophilus tRNA-Gly
  850. Neobacillus sedimentimangrovi tRNA-Gly
  851. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Gly
  852. Neobacillus sp. 204 tRNA-Gly
  853. Neobacillus sp. 3P2-tot-E-2 tRNA-Gly
  854. Neobacillus sp. CF12 tRNA-Gly
  855. Neobacillus sp. DY30 tRNA-Gly
  856. Neobacillus sp. GCM10023253 tRNA-Gly
  857. Neobacillus sp. GCM10027624 tRNA-Gly
  858. Neobacillus rhizosphaerae tRNA-Gly
  859. Neobacillus sp. KR4-4 tRNA-Gly
  860. Neobacillus sp. NPDC058068 tRNA-Gly
  861. Neobacillus sp. NPDC093127 tRNA-Gly
  862. Neobacillus sp. NPDC093182 tRNA-Gly
  863. Neobacillus sp. NPDC097160 tRNA-Gly
  864. Neobacillus sp. OS1-32 tRNA-Gly
  865. Neobacillus sp. PS2-9 tRNA-Gly
  866. Neobacillus sp. PS3-34 tRNA-Gly
  867. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Gly
  868. Neobacillus sp. SuZ13 tRNA-Gly
  869. Neobacillus sp. tRNA-Gly
  870. Neobacillus sp. WH10 tRNA-Gly
  871. Neobacillus sp. YX16 tRNA-Gly
  872. Neobacillus thermocopriae tRNA-Gly
  873. Neobacillus vireti tRNA-Gly
  874. Niallia hominis tRNA-Gly
  875. Niallia oryzisoli tRNA-Gly
  876. Niallia sp. FSL K6-0077 tRNA-Gly
  877. Niallia sp. FSL K6-0212 tRNA-Gly
  878. Niallia sp. FSL M8-0099 tRNA-Gly
  879. Niallia sp. FSL R7-0648 tRNA-Gly
  880. Niallia sp. FSL W8-0177 tRNA-Gly
  881. Niallia sp. FSL W8-0635 tRNA-Gly
  882. Niallia sp. FSL W8-0951 tRNA-Gly
  883. Niallia sp. FSL W8-0954 tRNA-Gly
  884. Niallia sp. FSL W8-1348 tRNA-Gly
  885. Niallia tiangongensis Niallia sp. JL1B1071 tRNA-Gly
  886. Niallia sp. RD1 tRNA-Gly
  887. Niallia sp. tRNA-Gly
  888. Niallia sp. XMNu-256 tRNA-Gly
  889. Nocardia panacis tRNA-Gly
  890. Nocardiopsis alba tRNA-Gly
  891. Nocardiopsis dassonvillei tRNA-Gly
  892. Nosocomiicoccus ampullae tRNA-Gly
  893. Nosocomiicoccus massiliensis tRNA-Gly
  894. Nosocomiicoccus sp. HMSC067E10 tRNA-Gly
  895. Nosocomiicoccus sp. HMSC09A07 tRNA-Gly
  896. Oceanobacillus aidingensis tRNA-Gly
  897. Oceanobacillus arenosus tRNA-Gly
  898. Oceanobacillus caeni tRNA-Gly
  899. Oceanobacillus chungangensis tRNA-Gly
  900. Oceanobacillus halophilus tRNA-Gly
  901. Oceanobacillus iheyensis HTE831 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  902. Oceanobacillus iheyensis tRNA-Gly
  903. Oceanobacillus indicireducens tRNA-Gly
  904. Oceanobacillus jeddahense tRNA-Gly
  905. Oceanobacillus jordanicus tRNA-Gly
  906. Oceanobacillus kapialis tRNA-Gly
  907. Oceanobacillus kimchii tRNA-Gly
  908. Oceanobacillus locisalsi tRNA-Gly
  909. Oceanobacillus longus tRNA-Gly
  910. Oceanobacillus luteolus tRNA-Gly
  911. Oceanobacillus oncorhynchi subsp. incaldanensis tRNA-Gly
  912. Oceanobacillus oncorhynchi subsp. oncorhynchi tRNA-Gly
  913. Oceanobacillus oncorhynchi tRNA-Gly
  914. Oceanobacillus picturae tRNA-Gly
  915. Oceanobacillus polygoni tRNA-Gly
  916. Oceanobacillus profundus tRNA-Gly
  917. Oceanobacillus sp. 143 tRNA-Gly
  918. Oceanobacillus zhaokaii tRNA-Gly
  919. Oceanobacillus sp. 1P07AA tRNA-Gly
  920. Oceanobacillus sp. E9 tRNA-Gly
  921. Oceanobacillus sp. FSL H7-0719 tRNA-Gly
  922. Oceanobacillus sp. FSL K6-0118 tRNA-Gly
  923. Oceanobacillus sp. FSL K6-0127 tRNA-Gly
  924. Oceanobacillus sp. FSL K6-0251 tRNA-Gly
  925. Oceanobacillus sp. FSL K6-2867 tRNA-Gly
  926. Oceanobacillus sp. FSL W7-1281 tRNA-Gly
  927. Oceanobacillus sp. FSL W7-1293 tRNA-Gly
  928. Oceanobacillus sp. FSL W7-1304 tRNA-Gly
  929. Oceanobacillus sp. FSL W7-1309 tRNA-Gly
  930. Oceanobacillus sp. HCA-5259 tRNA-Gly
  931. Oceanobacillus sp. ISL-73 tRNA-Gly
  932. Oceanobacillus sp. ISL-74 tRNA-Gly
  933. Oceanobacillus sp. J11TS1 tRNA-Gly
  934. Oceanobacillus sp. MO10714A tRNA-Gly
  935. Oceanobacillus sp. SE10311 tRNA-Gly
  936. Oceanobacillus piezotolerans tRNA-Gly
  937. Oikeobacillus pervagus tRNA-Gly
  938. Ornithinibacillus bavariensis tRNA-Gly
  939. Ornithinibacillus caprae tRNA-Gly
  940. Ornithinibacillus halotolerans tRNA-Gly
  941. Ornithinibacillus hominis tRNA-Gly
  942. Ornithinibacillus massiliensis tRNA-Gly
  943. Ornithinibacillus salinisoli tRNA-Gly
  944. Ornithinibacillus xuwenensis Ornithinibacillus sp. 16A2E tRNA-Gly
  945. Ornithinibacillus sp. 179-J 7C1 HS tRNA-Gly
  946. Ornithinibacillus sp. FSL M8-0202 tRNA-Gly
  947. Ornithinibacillus sp. JPR2-1 tRNA-Gly
  948. Paenibacillus sp. BSR1-1 tRNA-Gly
  949. Paenibacillus sp. FSL M7-1455 tRNA-Gly
  950. Pallidibacillus pasinlerensis tRNA-Gly
  951. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Gly
  952. Pantoea sp. tRNA-Gly
  953. Paraburkholderia tropica tRNA-Gly
  954. Perspicuibacillus lycopersici tRNA-Gly
  955. Piscibacillus salipiscarius tRNA-Gly
  956. Planococcus sp. SIMBA_143 tRNA-Gly
  957. Plantactinospora veratri tRNA-Gly
  958. Pontibacillus chungwhensis BH030062 tRNA-Gly
  959. Pontibacillus chungwhensis tRNA-Gly
  960. Pontibacillus litoralis JSM 072002 tRNA-Gly
  961. Pontibacillus salicampi tRNA-Gly
  962. Pontibacillus salipaludis tRNA-Gly
  963. Pontibacillus sp. ALD_SL1 tRNA-Gly
  964. Pontibacillus sp. HMF3514 tRNA-Gly
  965. Pontibacillus yanchengensis tRNA-Gly
  966. Pontibacillus yanchengensis Y32 tRNA-Gly
  967. Pradoshia sp. D12 tRNA-Gly
  968. Priestia sp. WB3 tRNA-Gly
  969. Pseudalkalibacillus sp. A8 tRNA-Gly
  970. Pseudalkalibacillus nanhaiensis Pseudalkalibacillus sp. SCS-8 tRNA-Gly
  971. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Gly
  972. Pseudobacillus sp. FSL P4-0506 tRNA-Gly
  973. Pseudoclavibacter sp. RFBJ3 tRNA-Gly
  974. Pseudomonas aeruginosa tRNA-Gly
  975. Bacillus subtilis A29 tRNA-Gly
  976. Pseudomonas sp. EGD-AK9 tRNA-Gly
  977. Pseudomonas sp. GW456-E7 tRNA-Gly
  978. Pseudomonas sp. ISL-88 tRNA-Gly
  979. Pseudoneobacillus rhizosphaerae tRNA-Gly
  980. Pseudoneobacillus sp. tRNA-Gly
  981. Pullulanibacillus camelliae tRNA-Gly
  982. Pullulanibacillus pueri tRNA-Gly
  983. Radiobacillus kanasensis tRNA-Gly
  984. Ralstonia insidiosa tRNA-Gly
  985. Rathayibacter sp. RFBD1 tRNA-Gly
  986. Rathayibacter toxicus tRNA-Gly
  987. Rathayibacter tritici tRNA-Gly
  988. Rhizobium rhizogenes tRNA-Gly
  989. Rhizobium ruizarguesonis tRNA-Gly
  990. Rhodococcus cercidiphylli tRNA-Gly
  991. Rhodococcus koreensis tRNA-Gly
  992. Rhodococcus qingshengii tRNA-Gly
  993. Rhodococcus zopfii tRNA-Gly
  994. Anoxybacillus andreesenii tRNA-Gly
  995. Robertmurraya crescens tRNA-Gly
  996. Robertmurraya siralis tRNA-Gly
  997. Robertmurraya sp. 2P01SA tRNA-Gly
  998. Robertmurraya sp. FSL W8-0741 tRNA-Gly
  999. Roseburia sp. 1XD42-34 tRNA-Gly
  1000. Rossellomorea aquimaris tRNA-Gly
  1001. Rossellomorea oryzaecorticis tRNA-Gly
  1002. Rossellomorea sp. AcN35-11 tRNA-Gly
  1003. Rossellomorea sp. DA94 tRNA-Gly
  1004. Rossellomorea sp. GCM10028870 tRNA-Gly
  1005. Rossellomorea sp. KS-H15a tRNA-Gly
  1006. Rossellomorea sp. LJF3 tRNA-Gly
  1007. Rossellomorea sp. NPDC077527 tRNA-Gly
  1008. Rossellomorea sp. SC111 tRNA-Gly
  1009. Rossellomorea sp. y25 tRNA-Gly
  1010. Rossellomorea yichunensis tRNA-Gly
  1011. Rossellomorea sp. YZS02 tRNA-Gly
  1012. Salibacterium lacus tRNA-Gly
  1013. Salibacterium qingdaonense tRNA_Gly_GCC
  1014. Salibacterium salarium tRNA-Gly
  1015. Salinibacillus aidingensis tRNA-Gly
  1016. Salinibacillus xinjiangensis tRNA-Gly
  1017. Salinicoccus halitifaciens tRNA-Gly
  1018. Salinicoccus jeotgali tRNA-Gly
  1019. Salinicoccus roseus tRNA-Gly
  1020. Salinicoccus siamensis tRNA-Gly
  1021. Salinicoccus bachuensis Salinicoccus sp. Bachu38 tRNA-Gly
  1022. Salinimicrobium profundisediminis tRNA-Gly
  1023. Salirhabdus euzebyi tRNA-Gly
  1024. Salmonella enterica subsp. enterica serovar Stanley tRNA-Gly
  1025. Schinkia azotoformans tRNA-Gly
  1026. Sediminibacillus dalangtanensis tRNA-Gly
  1027. Shigella flexneri tRNA-Gly
  1028. Bacillus velezensis A3 tRNA-Gly
  1029. Staphylococcaceae bacterium DP2N0-1 tRNA-Gly
  1030. Staphylococcus aureus tRNA-Gly
  1031. Staphylococcus borealis tRNA-Gly
  1032. Staphylococcus capitis C87 tRNA-Gly
  1033. Staphylococcus capitis SK14 tRNA-Gly
  1034. Staphylococcus capitis subsp. capitis tRNA-Gly
  1035. Staphylococcus capitis subsp. urealyticus tRNA-Gly
  1036. Staphylococcus capitis tRNA-Gly
  1037. Staphylococcus capitis VCU116 tRNA-Gly
  1038. Staphylococcus caprae tRNA-Gly
  1039. Staphylococcus carnosus tRNA-Gly
  1040. Staphylococcus devriesei tRNA-Gly
  1041. Staphylococcus epidermidis 14.1.R1.SE tRNA-Gly
  1042. Staphylococcus epidermidis 41tr tRNA-Gly
  1043. Staphylococcus epidermidis 528m tRNA-Gly
  1044. Staphylococcus epidermidis APO27 tRNA-Gly
  1045. Staphylococcus epidermidis ATCC 12228 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1046. Staphylococcus epidermidis AU12-03 tRNA-Gly
  1047. Staphylococcus epidermidis BCM-HMP0060 tRNA-Gly
  1048. Staphylococcus epidermidis BVS058A4 tRNA-Gly
  1049. Staphylococcus epidermidis CIM28 tRNA-Gly
  1050. Staphylococcus epidermidis CIM40 tRNA-Gly
  1051. Staphylococcus epidermidis FRI909 tRNA-Gly
  1052. Staphylococcus epidermidis FS1 tRNA-Gly
  1053. Staphylococcus epidermidis IS-250 tRNA-Gly
  1054. Staphylococcus epidermidis IS-K tRNA-Gly
  1055. Staphylococcus epidermidis M0026 tRNA-Gly
  1056. Staphylococcus epidermidis M0881 tRNA-Gly
  1057. Staphylococcus epidermidis M23864:W2(grey) tRNA-Gly
  1058. Staphylococcus epidermidis MC28 tRNA-Gly
  1059. Staphylococcus epidermidis NIH04003 tRNA-Gly
  1060. Staphylococcus epidermidis NIH04008 tRNA-Gly
  1061. Staphylococcus epidermidis NIH05001 tRNA-Gly
  1062. Staphylococcus epidermidis NIH05003 tRNA-Gly
  1063. Staphylococcus epidermidis NIH05005 tRNA-Gly
  1064. Staphylococcus epidermidis NIH051475 tRNA-Gly
  1065. Staphylococcus epidermidis NIH051668 tRNA-Gly
  1066. Staphylococcus epidermidis NIH06004 tRNA-Gly
  1067. Staphylococcus epidermidis NIH08001 tRNA-Gly
  1068. Staphylococcus epidermidis NIHLM001 tRNA-Gly
  1069. Staphylococcus epidermidis NIHLM003 tRNA-Gly
  1070. Staphylococcus epidermidis NIHLM008 tRNA-Gly
  1071. Staphylococcus epidermidis NIHLM015 tRNA-Gly
  1072. Staphylococcus epidermidis NIHLM018 tRNA-Gly
  1073. Staphylococcus epidermidis NIHLM020 tRNA-Gly
  1074. Staphylococcus epidermidis NIHLM021 tRNA-Gly
  1075. Staphylococcus epidermidis NIHLM023 tRNA-Gly
  1076. Staphylococcus epidermidis NIHLM031 tRNA-Gly
  1077. Staphylococcus epidermidis NIHLM037 tRNA-Gly
  1078. Staphylococcus epidermidis NIHLM039 tRNA-Gly
  1079. Staphylococcus epidermidis NIHLM040 tRNA-Gly
  1080. Staphylococcus epidermidis NIHLM049 tRNA-Gly
  1081. Staphylococcus epidermidis NIHLM053 tRNA-Gly
  1082. Staphylococcus epidermidis NIHLM057 tRNA-Gly
  1083. Staphylococcus epidermidis NIHLM061 tRNA-Gly
  1084. Staphylococcus epidermidis NIHLM067 tRNA-Gly
  1085. Staphylococcus epidermidis NIHLM070 tRNA-Gly
  1086. Staphylococcus epidermidis NIHLM087 tRNA-Gly
  1087. Staphylococcus epidermidis NIHLM088 tRNA-Gly
  1088. Staphylococcus epidermidis NIHLM095 tRNA-Gly
  1089. Staphylococcus epidermidis PM221 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1090. Staphylococcus epidermidis RP62A tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1091. Staphylococcus epidermidis Scl19 tRNA-Gly
  1092. Staphylococcus epidermidis SK135 tRNA-Gly
  1093. Staphylococcus epidermidis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1094. Staphylococcus epidermidis VCU028 tRNA-Gly
  1095. Staphylococcus epidermidis VCU037 tRNA-Gly
  1096. Staphylococcus epidermidis VCU041 tRNA-Gly
  1097. Staphylococcus epidermidis VCU045 tRNA-Gly
  1098. Staphylococcus epidermidis VCU057 tRNA-Gly
  1099. Staphylococcus epidermidis VCU065 tRNA-Gly
  1100. Staphylococcus epidermidis VCU071 tRNA-Gly
  1101. Staphylococcus epidermidis VCU105 tRNA-Gly
  1102. Staphylococcus epidermidis VCU109 tRNA-Gly
  1103. Staphylococcus epidermidis VCU112 tRNA-Gly
  1104. Staphylococcus epidermidis VCU117 tRNA-Gly
  1105. Staphylococcus epidermidis VCU118 tRNA-Gly
  1106. Staphylococcus epidermidis VCU120 tRNA-Gly
  1107. Staphylococcus epidermidis VCU123 tRNA-Gly
  1108. Staphylococcus epidermidis VCU125 tRNA-Gly
  1109. Staphylococcus epidermidis VCU126 tRNA-Gly
  1110. Staphylococcus epidermidis VCU127 tRNA-Gly
  1111. Staphylococcus epidermidis VCU128 tRNA-Gly
  1112. Staphylococcus epidermidis VCU129 tRNA-Gly
  1113. Staphylococcus epidermidis VCU144 tRNA-Gly
  1114. Staphylococcus epidermidis W23144 tRNA-Gly
  1115. Staphylococcus epidermidis WI05 tRNA-Gly
  1116. Staphylococcus epidermidis WI09 tRNA-Gly
  1117. Staphylococcus equorum subsp. equorum tRNA-Gly
  1118. Staphylococcus haemolyticus JCSC1435 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1119. Staphylococcus haemolyticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  1120. Staphylococcus hominis SK119 tRNA-Gly
  1121. Staphylococcus hominis subsp. hominis C80 tRNA-Gly
  1122. Staphylococcus hominis subsp. hominis tRNA-Gly
  1123. Staphylococcus hominis subsp. novobiosepticus tRNA-Gly
  1124. Staphylococcus hominis tRNA-Gly
  1125. Staphylococcus hominis VCU122 tRNA-Gly
  1126. Staphylococcus croceilyticus tRNA-Gly
  1127. Staphylococcus petrasii tRNA-Gly(gcc)
  1128. Staphylococcus petrasii tRNA-Gly(gcc)
  1129. Staphylococcus pragensis tRNA-Gly
  1130. Staphylococcus petrasii tRNA-Gly
  1131. Staphylococcus saccharolyticus tRNA-Gly
  1132. Staphylococcus saprophyticus tRNA-Gly
  1133. Staphylococcus borealis tRNA-Gly
  1134. Staphylococcus sp. EG-SA-6 tRNA-Gly
  1135. Staphylococcus sp. FR041 tRNA-Gly
  1136. Staphylococcus sp. FR124 tRNA-Gly
  1137. Staphylococcus sp. FSL C8-0035 tRNA-Gly
  1138. Staphylococcus sp. FSL H8-0476 tRNA-Gly
  1139. Staphylococcus sp. FSL K6-0099 tRNA-Gly
  1140. Staphylococcus sp. FSL K6-0223 tRNA-Gly
  1141. Staphylococcus sp. FSL M7-0405 tRNA-Gly
  1142. Staphylococcus sp. FSL M8-0207 tRNA-Gly
  1143. Staphylococcus sp. FSL W8-0097 tRNA-Gly
  1144. Staphylococcus sp. FSL W8-0304 tRNA-Gly
  1145. Staphylococcus sp. FSL W8-0436 tRNA-Gly
  1146. Staphylococcus sp. FSL W8-1268 tRNA-Gly
  1147. Staphylococcus sp. FSL W8-1270 tRNA-Gly
  1148. Staphylococcus sp. FSL W8-1291 tRNA-Gly
  1149. Staphylococcus sp. GCP4 tRNA-Gly
  1150. Staphylococcus sp. GDX7P312P tRNA-Gly
  1151. Staphylococcus sp. GDX7P459A tRNA-Gly
  1152. Staphylococcus sp. HMSC034A07 tRNA-Gly
  1153. Staphylococcus sp. HMSC034C12 tRNA-Gly
  1154. Staphylococcus sp. HMSC034G11 tRNA-Gly
  1155. Staphylococcus sp. HMSC035D11 tRNA-Gly
  1156. Staphylococcus sp. HMSC035F02 tRNA-Gly
  1157. Staphylococcus sp. HMSC055A09 tRNA-Gly
  1158. Staphylococcus sp. HMSC055A10 tRNA-Gly
  1159. Staphylococcus sp. HMSC057A02 tRNA-Gly
  1160. Staphylococcus sp. HMSC057A08 tRNA-Gly
  1161. Staphylococcus sp. HMSC058D09 tRNA-Gly
  1162. Staphylococcus sp. HMSC059G05 tRNA-Gly
  1163. Staphylococcus sp. HMSC061F01 tRNA-Gly
  1164. Staphylococcus sp. HMSC061F10 tRNA-Gly
  1165. Staphylococcus sp. HMSC061G04 tRNA-Gly
  1166. Staphylococcus sp. HMSC061H04 tRNA-Gly
  1167. Staphylococcus sp. HMSC062A01 tRNA-Gly
  1168. Staphylococcus sp. HMSC062C01 tRNA-Gly
  1169. Staphylococcus sp. HMSC062C03 tRNA-Gly
  1170. Staphylococcus sp. HMSC063F02 tRNA-Gly
  1171. Staphylococcus sp. HMSC065C09 tRNA-Gly
  1172. Staphylococcus sp. HMSC065C10 tRNA-Gly
  1173. Staphylococcus sp. HMSC065D05 tRNA-Gly
  1174. Staphylococcus sp. HMSC065D11 tRNA-Gly
  1175. Staphylococcus sp. HMSC066C03 tRNA-Gly
  1176. Staphylococcus sp. HMSC067B04 tRNA-Gly
  1177. Staphylococcus sp. HMSC067G10 tRNA-Gly
  1178. Staphylococcus sp. HMSC068C09 tRNA-Gly
  1179. Staphylococcus sp. HMSC068D03 tRNA-Gly
  1180. Staphylococcus sp. HMSC068D07 tRNA-Gly
  1181. Staphylococcus sp. HMSC068G12 tRNA-Gly
  1182. Staphylococcus sp. HMSC068H08 tRNA-Gly
  1183. Staphylococcus sp. HMSC069D04 tRNA-Gly
  1184. Staphylococcus sp. HMSC069D07 tRNA-Gly
  1185. Staphylococcus sp. HMSC069D12 tRNA-Gly
  1186. Staphylococcus sp. HMSC069E07 tRNA-Gly
  1187. Staphylococcus sp. HMSC069E10 tRNA-Gly
  1188. Staphylococcus sp. HMSC070A07 tRNA-Gly
  1189. Staphylococcus sp. HMSC072D04 tRNA-Gly
  1190. Staphylococcus sp. HMSC072H03 tRNA-Gly
  1191. Staphylococcus sp. HMSC074B09 tRNA-Gly
  1192. Staphylococcus sp. HMSC074C02 tRNA-Gly
  1193. Staphylococcus sp. HMSC074C12 tRNA-Gly
  1194. Staphylococcus sp. HMSC074D07 tRNA-Gly
  1195. Staphylococcus sp. HMSC074F11 tRNA-Gly
  1196. Staphylococcus sp. HMSC075A04 tRNA-Gly
  1197. Staphylococcus sp. HMSC075F12 tRNA-Gly
  1198. Staphylococcus sp. HMSC075H09 tRNA-Gly
  1199. Staphylococcus sp. HMSC076B11 tRNA-Gly
  1200. Staphylococcus sp. HMSC076E07 tRNA-Gly
  1201. Staphylococcus sp. HMSC077B09 tRNA-Gly
  1202. Staphylococcus sp. HMSC078A03 tRNA-Gly
  1203. Staphylococcus sp. HMSC078A08 tRNA-Gly
  1204. Staphylococcus sp. HMSC078B01 tRNA-Gly
  1205. Staphylococcus sp. HMSC078D05 tRNA-Gly
  1206. Staphylococcus sp. HMSC14C01 tRNA-Gly
  1207. Staphylococcus sp. HMSC14C08 tRNA-Gly
  1208. Staphylococcus sp. HMSC34G04 tRNA-Gly
  1209. Staphylococcus sp. HMSC36A02 tRNA-Gly
  1210. Staphylococcus sp. HMSC62A08 tRNA-Gly
  1211. Staphylococcus sp. HMSC62B09 tRNA-Gly
  1212. Staphylococcus sp. M0480 tRNA-Gly
  1213. Staphylococcus sp. MB377 tRNA-Gly
  1214. Staphylococcus sp. (metagenome) tRNA-Gly
  1215. Staphylococcus sp. NRL 16/872 tRNA-Gly
  1216. Staphylococcus sp. RIT622 tRNA-Gly
  1217. Staphylococcus sp. SIMBA_130 tRNA-Gly
  1218. Staphylococcus sp. SKL70935 tRNA-Gly
  1219. Staphylococcus sp. SKL71187 tRNA-Gly
  1220. Staphylococcus sp. TE8 tRNA-Gly
  1221. Staphylococcus taiwanensis tRNA-Gly
  1222. Streptococcus anginosus tRNA-Gly
  1223. Streptococcus mitis tRNA-Gly
  1224. Streptococcus pneumoniae tRNA-Gly
  1225. Streptococcus pyogenes tRNA-Gly
  1226. Streptomyces albidoflavus tRNA-Gly
  1227. Streptomyces anulatus tRNA-Gly
  1228. Streptomyces bikiniensis tRNA-Gly
  1229. Streptomyces chartreusis tRNA-Gly
  1230. Streptomyces cyaneofuscatus tRNA-Gly
  1231. Streptomyces goshikiensis tRNA-Gly
  1232. Streptomyces griseoincarnatus tRNA-Gly
  1233. Streptomyces gulbargensis tRNA-Gly
  1234. Streptomyces hydrogenans tRNA-Gly
  1235. Streptomyces massasporeus tRNA-Gly
  1236. Streptomyces mirabilis tRNA-Gly
  1237. Streptomyces niveus tRNA-Gly
  1238. Streptomyces noursei tRNA-Gly
  1239. Streptomyces olivaceus tRNA-Gly
  1240. Streptomyces roseolus tRNA-Gly
  1241. Streptomyces rubiginosohelvolus tRNA-Gly
  1242. Streptomyces scopuliridis tRNA-Gly
  1243. Streptomyces sp. ARC32 tRNA-Gly
  1244. Streptomyces sp. NPDC053429 tRNA-Gly
  1245. Streptomyces sp. NPDC056084 tRNA-Gly
  1246. Streptomyces sp. NPDC056127 tRNA-Gly
  1247. Streptomyces sp. NPDC056647 tRNA-Gly
  1248. Streptomyces sp. NPDC056831 tRNA-Gly
  1249. Streptomyces sp. NPDC056853 tRNA-Gly
  1250. Streptomyces sp. NPDC057011 tRNA-Gly
  1251. Streptomyces sp. NPDC057582 tRNA-Gly
  1252. Streptomyces sp. NPDC057600 tRNA-Gly
  1253. Streptomyces sp. NPDC057611 tRNA-Gly
  1254. Streptomyces sp. NPDC057620 tRNA-Gly
  1255. Streptomyces sp. NPDC057748 tRNA-Gly
  1256. Streptomyces sp. NPDC057888 tRNA-Gly
  1257. Streptomyces sp. NPDC057939 tRNA-Gly
  1258. Streptomyces sp. NPDC057963 tRNA-Gly
  1259. Streptomyces sp. NPDC058001 tRNA-Gly
  1260. Streptomyces sp. NPDC058195 tRNA-Gly
  1261. Streptomyces sp. NPDC059873 tRNA-Gly
  1262. Streptomyces sp. NPDC059919 tRNA-Gly
  1263. Streptomyces sp. NPDC059990 tRNA-Gly
  1264. Sutcliffiella cohnii tRNA-Gly
  1265. Sutcliffiella horikoshii tRNA-Gly
  1266. Sutcliffiella sp. FSL R7-0096 tRNA-Gly
  1267. Sutcliffiella sp. NC1 tRNA-Gly
  1268. Sutcliffiella sp. NPDC057660 tRNA-Gly
  1269. Tenuibacillus multivorans tRNA-Gly
  1270. Terribacillus halophilus tRNA-Gly
  1271. Terribacillus sp. 179-K 1B1 HS tRNA-Gly
  1272. Terribacillus sp. FSL K6-0262 tRNA-Gly
  1273. Terrihalobacillus insolitus tRNA-Gly
  1274. Thalassobacillus devorans tRNA-Gly
  1275. Thalassobacillus hwangdonensis tRNA-Gly
  1276. Thalassorhabdus alkalitolerans tRNA-Gly
  1277. Tigheibacillus jepli tRNA-Gly
  1278. Tistrella mobilis tRNA-Gly
  1279. Geobacillus kaustophilus tRNA-Gly from Geobacillus kaustophilus (PDB 6PMO, chain B)
  1280. Variovorax sp. CCNWLW225 tRNA-Gly
  1281. Veillonella sp. tRNA-Gly
  1282. Virgibacillus alimentarius tRNA-Gly
  1283. Virgibacillus dakarensis tRNA-Gly
  1284. Virgibacillus dokdonensis tRNA-Gly
  1285. Virgibacillus halodenitrificans tRNA-Gly
  1286. Tigheibacillus halophilus Virgibacillus halophilus tRNA-Gly
  1287. Virgibacillus indicus tRNA-Gly
  1288. Virgibacillus kapii tRNA-Gly
  1289. Virgibacillus kekensis tRNA-Gly
  1290. Virgibacillus litoralis tRNA-Gly
  1291. Virgibacillus massiliensis tRNA-Gly
  1292. Virgibacillus natechei tRNA-Gly
  1293. Virgibacillus oceani tRNA-Gly
  1294. Virgibacillus pantothenticus tRNA-Gly
  1295. Virgibacillus profundi tRNA-Gly
  1296. Virgibacillus proomii tRNA-Gly
  1297. Virgibacillus sediminis tRNA-Gly
  1298. Virgibacillus siamensis tRNA-Gly
  1299. Paracerasibacillus soli tRNA-Gly
  1300. Virgibacillus sp. 19R1-5 tRNA-Gly
  1301. Virgibacillus sp. 6R tRNA-Gly
  1302. Virgibacillus tibetensis Virgibacillus sp. C22-A2 tRNA-Gly
  1303. Virgibacillus sp. CBA3643 tRNA-Gly
  1304. Virgibacillus sp. CM-4 tRNA-Gly
  1305. Virgibacillus sp. (food fermentation metagenome) tRNA-Gly
  1306. Virgibacillus sp. JSM 102003 tRNA-Gly
  1307. Virgibacillus sp. M23 tRNA-Gly
  1308. Virgibacillus sp. MSP4-1 tRNA-Gly
  1309. Virgibacillus saliphilus tRNA-Gly
  1310. Virgibacillus sp. SK37 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  1311. Virgibacillus xinjiangensis tRNA-Gly
  1312. Weizmannia acidilactici tRNA-Gly
  1313. Yersinia enterocolitica tRNA-Gly
Relationships

Molecular Relationships

2D structure

Loading 2D structure...