v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cynara cardunculus (wild artichoke) cca-miR167 URS00005027A3_4265

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAAGCUGCCAGCAUGAUCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR167d-5p
  2. Arabidopsis thaliana (thale cress) ath-miR167d
  3. Eugenia uniflora (Brazil-cherry) eun-miR167b-5p
  4. Nicotiana attenuata microRNA mir-167-like
  5. Nicotiana tabacum (common tobacco) nta-miR167c
  6. Picea abies (Norway spruce) pab-miR167b
  7. Ricinus communis rco-miR167c
 Publications