v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nicotiana tabacum (common tobacco) nta-miR167c URS00005027A3_4097

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAAGCUGCCAGCAUGAUCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR167d-5p
  2. Arabidopsis thaliana (thale cress) ath-miR167d
  3. Cynara cardunculus (wild artichoke) cca-miR167
  4. Eugenia uniflora (Brazil-cherry) eun-miR167b-5p
  5. Nicotiana attenuata microRNA mir-167-like
  6. Picea abies (Norway spruce) pab-miR167b
  7. Ricinus communis rco-miR167c
 Publications