v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR396f-3p URS0000501BC6_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (RefSeq, miRBase, ENA). Zea mays zma-miR396f-3p sequence is a product of zma-miR396f, miR396f, miR396f-3p, miR396, zma-miR396f-3p, MIR396f genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    GGUCAAGAAAGCUGUGGGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4 other species

    1. Aegilops tauschii ata-miR396c-3p
    2. Brachypodium distachyon (stiff brome) bdi-miR396e-3p
    3. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396c-3p
    4. Oryza sativa (rice) osa-miR396c-3p
     Publications