Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gga-Mir-1306_5p (mature (guide)) URS0000500449_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCUCCCCUGCAAACGUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis Ami-Mir-1306_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-1306_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-1306_5p (mature (guide))
  4. Callithrix jacchus cja-miR-1306
  5. Callorhinchus milii Cmi-Mir-1306_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-1306_5p (mature (guide))
  7. Cavia porcellus (domestic guinea pig) Cpo-Mir-1306_5p (mature (guide))
  8. Cervus elaphus cel-miR-1306
  9. Chrysemys picta bellii Cpi-Mir-1306_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-1306-5p
  11. Columba livia Cli-Mir-1306_5p (mature (guide))
  12. Danio rerio dre-miR-1306
  13. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-1306_5p (mature (guide))
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1306_5p (mature (guide))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-1306_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-1306_5p (mature (guide))
  17. Homo sapiens hsa-miR-1306-5p
  18. Latimeria chalumnae Lch-Mir-1306_5p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-1306_5p (mature (guide))
  20. Macaca mulatta Mml-Mir-1306_5p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-1306_5p (mature (co-guide))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-1306_5p (mature (guide))
  23. Monopterus albus (swamp eel) Mal-Mir-1306_5p (mature (guide))
  24. Mus musculus (house mouse) Mmu-Mir-1306_5p (mature (guide))
  25. Ornithorhynchus anatinus (platypus) Oan-Mir-1306_5p (mature (guide))
  26. Oryctolagus cuniculus Ocu-Mir-1306_5p (mature (guide))
  27. Python bivittatus (Burmese python) Pbv-Mir-1306_5p (mature (guide))
  28. Rattus norvegicus rno-miR-1306-5p
  29. Sarcophilus harrisii Sha-Mir-1306_5p (mature (guide))
  30. Sphenodon punctatus (tuatara) Spt-Mir-1306_5p (mature (guide))
  31. Sus scrofa (pig) ssc-miR-1306-5p
  32. Taeniopygia guttata Tgu-Mir-1306_5p (mature (guide))
  33. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-1306_5p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-1306
  35. Tupaia chinensis tch-miR-1306-5p
  36. Xenopus laevis Xla-Mir-1306-P1b_5p (mature (guide))
  37. Xenopus tropicalis Xtr-Mir-1306_5p (mature (co-guide))