Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1306-5p URS0000500449_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1306: Hsa-mir-1306 is a human pre-miRNA hairpin that has been identified in several studies [PMC9594041] [PMC9587983] [PMC9316571] [PMC5388392] [PMC6151886] [PMC3581547] [PMC3965395] [PMC7355149] [PMC9951117] [PMC3675212]. It is one of the miRNAs that have been retained in the network algorithm for kidney tissue interactions, along with hsa-mir-484 and hsa-mir-185, out of the ten miRNAs used for network creation [PMC9587983]. Hsa-mir-1306 is a relatively short miRNA consisting of 17 nucleotides [PMC9316571], and it has been associated with prognosis in certain conditions [PMC6151886]. It has also been found to be excluded from network analysis due to not meeting target gene prediction criteria [PMC3581547]. Hsa-mir-1306 is part of a cluster with hsa-miR-3618, and it has been linked to autism in CNV studies [PMC5388392]. Furthermore, it has been identified as one of the differential miRNAs in LIHC patients with low and high TMB [PMC7355149]. Hsa-mir-1306 has also shown regulatory effects on ADAM10 and resides within gene DGCR8, which is essential for miRNA biogenesis [PMC9951117] [PMC3675212]. Additionally, it is located within a genomic region implicated in DiGeorge syndrome and has been included in circRNA-miRNA-hub_gene networks [PMC6857072]. However, some studies have found that hsa-mir-1306 may not be related to cancer development as other SCNA-miRNAs are implicated [PMC6315597].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCUCCCCUGCAAACGUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis Ami-Mir-1306_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-1306_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-1306_5p (mature (guide))
  4. Callithrix jacchus cja-miR-1306
  5. Callorhinchus milii Cmi-Mir-1306_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-1306_5p (mature (guide))
  7. Cavia porcellus (domestic guinea pig) Cpo-Mir-1306_5p (mature (guide))
  8. Cervus elaphus cel-miR-1306
  9. Chrysemys picta bellii Cpi-Mir-1306_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-1306-5p
  11. Columba livia Cli-Mir-1306_5p (mature (guide))
  12. Danio rerio dre-miR-1306
  13. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-1306_5p (mature (guide))
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1306_5p (mature (guide))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-1306_5p (mature (guide))
  16. Gallus gallus Gga-Mir-1306_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-1306_5p (mature (guide))
  18. Latimeria chalumnae Lch-Mir-1306_5p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-1306_5p (mature (guide))
  20. Macaca mulatta Mml-Mir-1306_5p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-1306_5p (mature (co-guide))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-1306_5p (mature (guide))
  23. Monopterus albus (swamp eel) Mal-Mir-1306_5p (mature (guide))
  24. Mus musculus (house mouse) Mmu-Mir-1306_5p (mature (guide))
  25. Ornithorhynchus anatinus (platypus) Oan-Mir-1306_5p (mature (guide))
  26. Oryctolagus cuniculus Ocu-Mir-1306_5p (mature (guide))
  27. Python bivittatus (Burmese python) Pbv-Mir-1306_5p (mature (guide))
  28. Rattus norvegicus rno-miR-1306-5p
  29. Sarcophilus harrisii Sha-Mir-1306_5p (mature (guide))
  30. Sphenodon punctatus (tuatara) Spt-Mir-1306_5p (mature (guide))
  31. Sus scrofa (pig) ssc-miR-1306-5p
  32. Taeniopygia guttata Tgu-Mir-1306_5p (mature (guide))
  33. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-1306_5p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-1306
  35. Tupaia chinensis tch-miR-1306-5p
  36. Xenopus laevis Xla-Mir-1306-P1b_5p (mature (guide))
  37. Xenopus tropicalis Xtr-Mir-1306_5p (mature (co-guide))
Publications