Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-542-3p URS00004F859B_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 5 databases (PirBase, TarBase, ENA, RefSeq, miRBase). Described in 21 papers. Mus musculus (house mouse) mmu-miR-542-3p sequence is a product of mmu-miR-542-3p, Mir542, mmu-miR-542, miR-542-3p, miR-542 genes. Interacts with protein-coding genes, including 1110014L17Rik, 1110034O07Rik, 2310046M24Rik, 2610024B07Rik, 2610043E24Rik, 2610206H23Rik, 2610510H01Rik, 2610529N02Rik, 2700081O15Rik, 6430578P22Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGACAGAUUGAUAACUGAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Bos taurus (cattle) Bta-Mir-542_3p (mature (guide))
    2. Canis lupus familiaris (dog) cfa-miR-542
    3. Cavia porcellus cpo-miR-542-3p
    4. Cervus elaphus (red deer) cel-miR-542-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-542-3p
    6. Equus caballus eca-miR-542-3p
    7. Gorilla gorilla (western gorilla) ggo-miR-542
    8. Homo sapiens (human) hsa-miR-542-3p
    9. Macaca mulatta mml-miR-542-3p
    10. Microcebus murinus (gray mouse lemur) mmr-miR-542
    11. Nomascus leucogenys nle-miR-542
    12. Oryctolagus cuniculus ocu-miR-542-3p
    13. Pongo pygmaeus ppy-miR-542-3p
    14. Pteropus alecto (black flying fox) pal-miR-542-3p
    15. Rattus norvegicus rno-miR-542-3p
    16. Sus scrofa ssc-miR-542-3p
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-542-3p