Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-592_5p (mature (guide)) URS00004F507C_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGUCAAUAUGCGAUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-592_5p (mature (guide))
  2. Capra hircus (goat) chi-miR-592
  3. Cavia porcellus Cpo-Mir-592_5p (mature (guide))
  4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-592_5p (mature (guide))
  5. Echinops telfairi Ete-Mir-592_5p (mature (guide))
  6. Eptesicus fuscus efu-miR-592
  7. Equus caballus eca-miR-592
  8. Homo sapiens hsa-miR-592
  9. Macaca mulatta (Rhesus monkey) mml-miR-592-5p
  10. Mus musculus (house mouse) Mmu-Mir-592_5p (mature (guide))
  11. Oryctolagus cuniculus (rabbit) Ocu-Mir-592_5p (mature (guide))
  12. Pan troglodytes ptr-miR-592
  13. Pongo pygmaeus ppy-miR-592
  14. Rattus norvegicus Rno-Mir-592_5p (mature (guide))
  15. Tupaia chinensis tch-miR-592