Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mmu-Mir-592_5p (mature (guide)) URS00004F507C_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGUCAAUAUGCGAUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-592_5p (mature (guide))
  2. Canis lupus familiaris Cfa-Mir-592_5p (mature (guide))
  3. Capra hircus (goat) chi-miR-592
  4. Cavia porcellus Cpo-Mir-592_5p (mature (guide))
  5. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-592_5p (mature (guide))
  6. Echinops telfairi Ete-Mir-592_5p (mature (guide))
  7. Eptesicus fuscus efu-miR-592
  8. Equus caballus eca-miR-592
  9. Homo sapiens hsa-miR-592
  10. Macaca mulatta (Rhesus monkey) mml-miR-592-5p
  11. Oryctolagus cuniculus (rabbit) Ocu-Mir-592_5p (mature (guide))
  12. Pan troglodytes ptr-miR-592
  13. Pongo pygmaeus ppy-miR-592
  14. Rattus norvegicus Rno-Mir-592_5p (mature (guide))
  15. Tupaia chinensis tch-miR-592