Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-29a precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-29a precursor URS00004E9304_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-29a: Bta-mir-29a is a microRNA that has been studied in various contexts. It has been found to be expressed at relatively higher levels in the ovarian cortical portion, with higher expression in the adult ovarian cortex compared to the fetal ovary [PMC2762473]. Bta-mir-29a has also been investigated as a potential internal control miRNA in bovine milk sEVs for normalization in qPCR [PMC9961204]. In addition, it has been identified as one of the miRNAs associated with uterine proteins and exhibited a strong and positive association with SUGT1 and PPID [PMC8273763]. Bta-mir-29a has also shown different abundance levels in pregnant vs. non-pregnant cows, with higher abundance levels observed in cows that reached term [PMC5662615]. Furthermore, it has been found to be negatively correlated with lysosome expression [PMC9378797]. Overall, bta-mir-29a is a microRNA that plays a role in ovarian development, pregnancy, and uterine protein regulation. It is also being investigated for its potential use as an internal control miRNA and its association with lysosome expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Ailuropoda melanoleuca mir-29 microRNA precursor
  2. Aotus nancymaae miRNA (ENSANAG00000013314.1)
  3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-29a precursor
  4. Callithrix jacchus (white-tufted-ear marmoset) mir-29 microRNA precursor
  5. Canis lupus familiaris (dog) mir-29 microRNA precursor
  6. Capra hircus (Goat) microRNA mir-29a (ENSCHIG00000009009.1)
  7. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000023617.2)
  8. Cavia porcellus mir-29 microRNA precursor
  9. Cebus imitator microRNA 29a (ENSCCAG00000016206.1)
  10. Cercocebus atys miRNA (ENSCATG00000015753.1)
  11. Chlorocebus sabaeus mir-29 microRNA precursor
  12. Colobus angolensis palliatus miRNA (ENSCANG00000037675.1)
  13. Equus caballus mir-29 microRNA precursor
  14. Felis catus mir-29 microRNA precursor
  15. Fukomys damarensis mir-29 microRNA precursor
  16. Gorilla gorilla gorilla ggo-mir-29a (ENSGGOG00000032853.2)
  17. Gorilla gorilla microRNA ggo-mir-29a precursor
  18. Heterocephalus glaber (naked mole-rat) mir-29 microRNA precursor
  19. Homo sapiens microRNA hsa-mir-29a precursor
  20. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-29a precursor
  21. Loxodonta africana mir-29 microRNA precursor
  22. Macaca mulatta microRNA mml-mir-29a precursor
  23. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-29a precursor
  24. Mandrillus leucophaeus miRNA (ENSMLEG00000013113.1)
  25. Marmota monax (woodchuck) non-coding RNA
  26. Microcebus murinus (gray mouse lemur) mmr-mir-29a (ENSMICG00000018399.3)
  27. Nomascus leucogenys nle-mir-29a (ENSNLEG00000024513.2)
  28. Otolemur garnettii mir-29 microRNA precursor
  29. Ovis aries (sheep) microRNA oar-mir-29a precursor
  30. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-29a precursor
  31. Panthera pardus microRNA 29a (ENSPPRG00000014670.1)
  32. Panthera tigris altaica miRNA (ENSPTIG00000001473.1)
  33. Pan troglodytes microRNA ptr-mir-29a precursor
  34. Papio anubis mir-29 microRNA precursor
  35. Pongo abelii mir-29 microRNA precursor
  36. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29a precursor
  37. Propithecus coquereli miRNA (ENSPCOG00000008303.1)
  38. Rhinopithecus bieti miRNA (ENSRBIG00000008246.1)
  39. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000002738.1)
  40. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-29a precursor
  41. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000036361.1)
  42. Ictidomys tridecemlineatus mir-29 microRNA precursor
  43. Sus scrofa (pig) mir-29 microRNA precursor
  44. Tupaia chinensis mir-29 microRNA precursor
2D structure Publications