Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-29a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-29a precursor URS00004E9304_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR29A: MIR29A is a microRNA that is involved in various biological processes and diseases. It is a type of non-coding RNA that regulates gene expression. One study found that MIR29A, along with miR24, is primed by myocardin and plays a role in atherosclerosis retardation and matrix remodeling and fibrosis [PMC7123062]. In patients with non-small cell lung cancer (NSCLC), MIR29A levels were significantly lower compared to patients with small cell lung cancer (SCLC) [PMC9987486]. Additionally, MIR29A was found to be differentially expressed in pancreatic ductal (PD) compared to viral pancreatitis (VP) specimens, along with miR-23a and miR181c [PMC8407885]. The expression of MIR29A was also associated with patient prognosis, where elevated expression of certain microRNAs including MIR29A was correlated with poor patient survival [PMC6368411]. In liver fibrosis, TGF-β1 was found to downregulate MIR29A, potentially inducing the expression of Fstl1 [PMC7493388]. Furthermore, MIR29A has been found to be upregulated in breast cancer stem cells (BCSCs), aggressive breast cancer cell lines, and breast cancer tissues [PMC9102147]. Finally, the importance of MIR29A during the regression of liver fibrosis has been highlighted in a study [PMC6412626]. Overall, these findings demonstrate the diverse roles of MIR29A in various diseases and biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Ailuropoda melanoleuca mir-29 microRNA precursor
  2. Aotus nancymaae miRNA (ENSANAG00000013314.1)
  3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-29a precursor
  4. Bos taurus microRNA bta-mir-29a precursor
  5. Callithrix jacchus (white-tufted-ear marmoset) mir-29 microRNA precursor
  6. Canis lupus familiaris (dog) mir-29 microRNA precursor
  7. Capra hircus (Goat) microRNA mir-29a (ENSCHIG00000009009.1)
  8. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000023617.2)
  9. Cavia porcellus mir-29 microRNA precursor
  10. Cebus imitator microRNA 29a (ENSCCAG00000016206.1)
  11. Cercocebus atys miRNA (ENSCATG00000015753.1)
  12. Chlorocebus sabaeus mir-29 microRNA precursor
  13. Colobus angolensis palliatus miRNA (ENSCANG00000037675.1)
  14. Equus caballus mir-29 microRNA precursor
  15. Felis catus mir-29 microRNA precursor
  16. Fukomys damarensis mir-29 microRNA precursor
  17. Gorilla gorilla gorilla ggo-mir-29a (ENSGGOG00000032853.2)
  18. Gorilla gorilla microRNA ggo-mir-29a precursor
  19. Heterocephalus glaber (naked mole-rat) mir-29 microRNA precursor
  20. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-29a precursor
  21. Loxodonta africana mir-29 microRNA precursor
  22. Macaca mulatta microRNA mml-mir-29a precursor
  23. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-29a precursor
  24. Mandrillus leucophaeus miRNA (ENSMLEG00000013113.1)
  25. Marmota monax (woodchuck) non-coding RNA
  26. Microcebus murinus (gray mouse lemur) mmr-mir-29a (ENSMICG00000018399.3)
  27. Nomascus leucogenys nle-mir-29a (ENSNLEG00000024513.2)
  28. Otolemur garnettii mir-29 microRNA precursor
  29. Ovis aries (sheep) microRNA oar-mir-29a precursor
  30. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-29a precursor
  31. Panthera pardus microRNA 29a (ENSPPRG00000014670.1)
  32. Panthera tigris altaica miRNA (ENSPTIG00000001473.1)
  33. Pan troglodytes microRNA ptr-mir-29a precursor
  34. Papio anubis mir-29 microRNA precursor
  35. Pongo abelii mir-29 microRNA precursor
  36. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29a precursor
  37. Propithecus coquereli miRNA (ENSPCOG00000008303.1)
  38. Rhinopithecus bieti miRNA (ENSRBIG00000008246.1)
  39. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000002738.1)
  40. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-29a precursor
  41. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000036361.1)
  42. Ictidomys tridecemlineatus mir-29 microRNA precursor
  43. Sus scrofa (pig) mir-29 microRNA precursor
  44. Tupaia chinensis mir-29 microRNA precursor
2D structure Publications