Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-610 URS00004DC583_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-610: hsa-mir-610 is a microRNA that exhibits differential expression patterns influenced by the p53 status, being downregulated by mutant p53 and upregulated by wild-type p53 [PMC4905457]. It has been identified as a potential biomarker for favorable prognosis in patients, as it is overexpressed in those with good World Federation of Neurosurgical Societies (WFNS) grades at admission and positive outcomes at three months [PMC9732100]. In various studies, hsa-mir-610 has been shown to be upregulated in certain conditions, such as in the presence of progesterone support [PMC3462109], while it is downregulated or underexpressed in others, including comparisons between serum and cerebrospinal fluid (CSF) [PMC9738832], and between primary adrenocortical carcinoma (ACC) tissues and normal salivary gland tissues [PMC5929417]. Additionally, hsa-mir-610 is part of a constructed miRNA‒mRNA network that could be relevant for understanding miRNA‒mRNA interactions [PMC9676937], and specific primers for hsa-mir-610 are available for research purposes to facilitate its study [PMC5722568].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCUAAAUGUGUGCUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-610
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-610
Relationships

Molecular Relationships

GoFlow Results Publications