Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus tomentosa Pto-miR169m URS00004D7772_118781

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCCAAGGAUGACUUGCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aegilops tauschii ata-miR169i-5p
  2. Ananas comosus microRNA 169h
  3. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR169b
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR169j-5p
  5. Arabidopsis thaliana (thale cress) ath-miR169m
  6. Brachypodium distachyon (stiff brome) bdi-miR169e-5p
  7. Camelina sativa (false flax) cas-miR169g-5p
  8. Cucumis melo (muskmelon) cme-miR169n
  9. Gossypium herbaceum (Arabian cotton) ghb-miR169a
  10. Gossypium hirsutum ghr-miR169a
  11. Linum usitatissimum (flax) lus-miR169c
  12. Malus domestica (apple) mdm-miR169n
  13. Manihot esculenta mes-miR169s
  14. Musa AAB Group miR169
  15. Oryza sativa (Asian cultivated rice) osa-miR169k
  16. Oryza sativa Japonica Group microRNA osa-miR169h
  17. Pachycladon fastigiatum Pfa-miR169h
  18. Populus trichocarpa (black cottonwood) ptc-miR169k
  19. Solanum lycopersicum sly-miR169b
  20. Sorghum bicolor (sorghum) sbi-miR169g
  21. Theobroma cacao (cacao) tcc-miR169h
  22. Zea mays (maize) zma-miR169k-5p