Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00004CBCF2_559292

Automated summary: This snoRNA sequence is 188 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, IntAct, ENA, Rfam). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR32, RF01247). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR32 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-12512950 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-15095620 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACAUCAUAAUUAUAUCGCGAAUGUACUACUAGUAUAUGCAGUUUUCUUAAAAUUGCAGGGAAUGACUAAAAGCCCACGUUUUUCCCACUUUUAGUAGUACUGAAGCGUAGAUAGAUUGAACGUUGCUGGGCGCCUGGUGUUGAUCAUUUCUGAAAUGAGAUAUUGGGAAUCAGCUGUAUCUACAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR32
    2. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR32
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR32
    4. Saccharomyces cerevisiae YJM1355 SNR32
    5. Saccharomyces cerevisiae YJM1388 SNR32
    6. Saccharomyces cerevisiae YJM1389 SNR32
    7. Saccharomyces cerevisiae YJM1460 SNR32
    8. Saccharomyces cerevisiae YJM1549 SNR32
    9. Saccharomyces cerevisiae YJM1592 SNR32
    10. Saccharomyces cerevisiae YJM271 SNR32
    11. Saccharomyces cerevisiae YJM470 SNR32
    2D structure New