Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1388 SNR32 secondary structure diagram

Saccharomyces cerevisiae YJM1388 SNR32 URS00004CBCF2_1294360

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUCAUAAUUAUAUCGCGAAUGUACUACUAGUAUAUGCAGUUUUCUUAAAAUUGCAGGGAAUGACUAAAAGCCCACGUUUUUCCCACUUUUAGUAGUACUGAAGCGUAGAUAGAUUGAACGUUGCUGGGCGCCUGGUGUUGAUCAUUUCUGAAAUGAGAUAUUGGGAAUCAGCUGUAUCUACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Saccharomyces cerevisiae Small nucleolar RNA snR32
  2. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR32
  3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR32
  4. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  5. Saccharomyces cerevisiae YJM1355 SNR32
  6. Saccharomyces cerevisiae YJM1389 SNR32
  7. Saccharomyces cerevisiae YJM1460 SNR32
  8. Saccharomyces cerevisiae YJM1549 SNR32
  9. Saccharomyces cerevisiae YJM1592 SNR32
  10. Saccharomyces cerevisiae YJM271 SNR32
  11. Saccharomyces cerevisiae YJM470 SNR32
2D structure