Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-133a-3p URS00004C9052_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, miRBase, PSICQUIC, RefSeq, LncBase, TarBase, PirBase). Described in 51 papers. Mus musculus (house mouse) mmu-miR-133a-3p sequence is a product of Mir133a-2, mmu-miR-133a-3p, Mir133a-1, mmu-miR-133a, miR-133a, miR-133a-3p, miR-133 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (P)RR, 0610007D13Rik, 0610009O03Rik, 0610011C06Rik, 0610011D08Rik, 0610011N22Rik, 0610013E23Rik, 0610013I17Rik, 0610020I02Rik, 0610025G21Rik.

Interactions 16

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-133a-3p interacts with:

Interaction id Participant Synonyms
URS00004C9052_10090-0 F8VQ52 F8VQ52
URS00004C9052_10090-8 F8VQ52 F8VQ52
URS00004C9052_10090-9 P34971 P34971
URS00004C9052_10090-1 P34971 P34971
URS00004C9052_10090-2 P60766 P60766
URS00004C9052_10090-10 P60766 P60766
URS00004C9052_10090-11 P68181 P68181
URS00004C9052_10090-3 P68181 P68181
URS00004C9052_10090-4 Q5SQK1 Q5SQK1
URS00004C9052_10090-12 Q5SQK1 Q5SQK1
URS00004C9052_10090-13 Q8BG30 Q8BG30
URS00004C9052_10090-5 Q8BG30 Q8BG30
URS00004C9052_10090-6 Q8VCC8 Q8VCC8
URS00004C9052_10090-14 Q8VCC8 Q8VCC8
URS00004C9052_10090-7 Q9QUI0 Q9QUI0
URS00004C9052_10090-15 Q9QUI0 Q9QUI0

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGUCCCCUUCAACCAGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Alligator mississippiensis ami-miR-133a-3p
    2. Anolis carolinensis aca-miR-133a
    3. Bos taurus (cattle) bta-miR-133a
    4. Callorhinchus milii (elephant shark) cmi-miR-133-2
    5. Chrysemys picta bellii Cpi-Mir-133-P4-v1_3p (mature (guide))
    6. Chrysemys picta cpi-miR-133c-3p
    7. Ciona intestinalis Cin-Mir-133_3p (mature (guide))
    8. Columba livia Cli-Mir-133-P4-v1_3p (mature (guide))
    9. Danio rerio dre-miR-133a-3p
    10. Equus caballus eca-miR-133a
    11. Gallus gallus (chicken) Gga-Mir-133-P4-v1_3p (mature (guide))
    12. Homo sapiens (human) hsa-miR-133a-3p
    13. Macaca mulatta mml-miR-133c-3p
    14. Ophiophagus hannah oha-miR-133a-3p
    15. Pan troglodytes (chimpanzee) ptr-miR-133a
    16. Pongo pygmaeus ppy-miR-133c
    17. Rattus norvegicus rno-miR-133a-3p
    18. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P4-v1_3p (mature (guide))
    19. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P4-v1_3p (mature (guide))
    20. Takifugu rubripes fru-miR-133
    21. Tetraodon nigroviridis tni-miR-133