Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-133a URS00004C9052_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-133a: Bta-mir-133a is a microRNA that has been identified in various studies and has been found to have different target sites in different contexts [PMC7230347] [PMC7653039]. It has been implicated in various biological processes, including cancer suppression [PMC9343836]. In the context of cadmium-induced BMEC model, bta-mir-133a has been shown to function as a sponge for circRNA-08409 and target TGFB2 [PMC9707628]. Bta-mir-133a has also been found to be expressed in mammary tissue samples of Holstein cows and is associated with other miRNAs such as bta-miR-21-5p, bta-miR-99a-5p, bta-miR-146b, bta-miR-145, and bta-miR-2285 t [PMC8520644]. It is considered a muscle-specific miRNA in bovine and its expression levels have been reported to be 689 RCPM [PMC5003961]. In the context of postpartum transition, the expression of bta-mir-133a was found to be downregulated along with other miRNAs such as bta-miR144 and bta-miR378c [PMC9445238]. In another study, the expression of bta-mir-133a was increased in heat-stressed cows [PMC6309072]. Bta-mir-133a has also been implicated in the regulation of skeletal muscle development by inhibiting the expression of Pax7 through binding with LOC104975788 [PMC9149217]. Furthermore, it has been shown to be involved in regulating the NF-kappa B signaling pathway along with other miRNAs such as bta-miR214 and bta-mir1246 [PMC6600136]. Overall, bta-mir-133a is a versatile microRNA that plays a role in various biological processes in bovine.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUCCCCUUCAACCAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

Publications