v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-34b-3p URS00004C43E8_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 2 databases (RefSeq, miRBase). Oryctolagus cuniculus (rabbit) ocu-miR-34b-3p sequence is a product of MIR34B, ocu-miR-34b-3p, miR-34b-3p, miR-34b, ocu-miR-34b, miR-34 genes. Found in the Oryctolagus cuniculus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AAUCACUAACUCCACUGCCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Callithrix jacchus cja-miR-34b
    2. Canis lupus familiaris (dog) Cfa-Mir-34-P2a-v2_3p (mature (guide))
    3. Cavia porcellus (domestic guinea pig) cpo-miR-34b-3p
    4. Cricetulus griseus cgr-miR-34b-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34b-3p
    6. Echinops telfairi Ete-Mir-34-P2a_3p* (star (passenger))
    7. Equus caballus eca-miR-34b-3p
    8. Homo sapiens Hsa-Mir-34-P2a_3p (mature (co-guide))
    9. Macaca mulatta Mml-Mir-34-P2a_3p* (star (passenger))
    10. Monodelphis domestica mdo-miR-34b-3p
    11. Mus musculus (house mouse) mmu-miR-34b-3p
    12. Ornithorhynchus anatinus oan-miR-34b-3p
    13. Rattus norvegicus rno-miR-34b-3p
    14. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2a_3p* (star (passenger))
     Publications