v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-34b-3p URS00004C43E8_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 3 databases (RefSeq, miRBase, ENA). Monodelphis domestica (gray short-tailed opossum) mdo-miR-34b-3p sequence is a product of MIR34B, miR-34b-3p, miR-34, miR-34b, mdo-miR-34b-3p, mdo-miR-34b genes. Found in the Monodelphis domestica reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AAUCACUAACUCCACUGCCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Callithrix jacchus cja-miR-34b
    2. Canis lupus familiaris (dog) Cfa-Mir-34-P2a-v2_3p (mature (guide))
    3. Cavia porcellus (domestic guinea pig) cpo-miR-34b-3p
    4. Cricetulus griseus cgr-miR-34b-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34b-3p
    6. Echinops telfairi Ete-Mir-34-P2a_3p* (star (passenger))
    7. Equus caballus eca-miR-34b-3p
    8. Homo sapiens Hsa-Mir-34-P2a_3p (mature (co-guide))
    9. Macaca mulatta Mml-Mir-34-P2a_3p* (star (passenger))
    10. Mus musculus (house mouse) mmu-miR-34b-3p
    11. Ornithorhynchus anatinus oan-miR-34b-3p
    12. Oryctolagus cuniculus ocu-miR-34b-3p
    13. Rattus norvegicus rno-miR-34b-3p
    14. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2a_3p* (star (passenger))
     Publications