v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-16-5p URS00004BCD9C_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MalaCards, miRBase, GeneCards, IntAct, MirGeneDB, TarBase, ENA, RefSeq, LncBase). Homo sapiens (human) hsa-miR-16-5p sequence is a product of MIR16-1, miR-16, miR-16-5p, 16, MIR16-2, hsa-miR-16-5p, hsa-miR-16 genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 15E1.2, 16.3A5, 16A.

Interactions 70

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-16-5p interacts with:

Interaction id Participant Synonyms
EBI-21006461 intact:EBI-20558883 EBI-20558883 ENST00000372067.7 mrna_vegfa
EBI-20976618 intact:EBI-20976621 EBI-20976621 ENST00000346798 mrna_app
EBI-20976615 intact:EBI-20976628 EBI-20976628 ENST00000313005 mrna_bace
EBI-20994120 intact:EBI-20994123 EBI-20994123 ENST00000217086 mrna_sall4
EBI-21001375 intact:EBI-21001378 EBI-21001378 ENST00000460006 mrna_cds2
EBI-21001502 intact:EBI-21001511 EBI-21001511 ENST00000354570 mrna_map7
EBI-21001496 intact:EBI-21001532 EBI-21001532 ENST00000228437 mrna_prdm4
EBI-21003080 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21003215 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21003198 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21014055 intact:EBI-21014057 EBI-21014057 ENSMUST00000025263.14 mrna_tnfalfa
EBI-21014565 intact:EBI-21014454 EBI-21014454 ENSMUST00000102796.9 mrna_il12p40
EBI-21014878 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-21015638 intact:EBI-21015273 EBI-21015273 ENST00000376663.7 mrna_bmi1
EBI-21015270 intact:EBI-21015273 EBI-21015273 ENST00000376663.7 mrna_bmi1
URS00004BCD9C_9606-29 O14757 O14757
URS00004BCD9C_9606-0 O14757 O14757
URS00004BCD9C_9606-1 O15111 O15111
URS00004BCD9C_9606-2 P05067 P05067
URS00004BCD9C_9606-30 P05067 P05067
URS00004BCD9C_9606-26 P06213 P06213
URS00004BCD9C_9606-3 P09038 P09038
URS00004BCD9C_9606-31 P09038 P09038
URS00004BCD9C_9606-4 P10415 P10415
URS00004BCD9C_9606-32 P10415 P10415
URS00004BCD9C_9606-33 P10415 P10415
URS00004BCD9C_9606-5 P10415 P10415
URS00004BCD9C_9606-35 P11362 P11362
URS00004BCD9C_9606-7 P11362 P11362
URS00004BCD9C_9606-6 P11362 P11362
URS00004BCD9C_9606-34 P11362 P11362
URS00004BCD9C_9606-40 P15692 P15692
URS00004BCD9C_9606-10 P15692 P15692
URS00004BCD9C_9606-11 P15692 P15692
URS00004BCD9C_9606-27 P15692 P15692
URS00004BCD9C_9606-36 P15692 P15692
URS00004BCD9C_9606-37 P15692 P15692
URS00004BCD9C_9606-38 P15692 P15692
URS00004BCD9C_9606-39 P15692 P15692
URS00004BCD9C_9606-8 P15692 P15692
URS00004BCD9C_9606-9 P15692 P15692
URS00004BCD9C_9606-12 P17096 P17096
URS00004BCD9C_9606-41 P17096 P17096
URS00004BCD9C_9606-42 P23443 P23443
URS00004BCD9C_9606-13 P23443 P23443
URS00004BCD9C_9606-43 P24385 P24385
URS00004BCD9C_9606-14 P24385 P24385
URS00004BCD9C_9606-15 P24864 P24864
URS00004BCD9C_9606-44 P24864 P24864
URS00004BCD9C_9606-16 P30291 P30291
URS00004BCD9C_9606-45 P30291 P30291
URS00004BCD9C_9606-46 P35968 P35968
URS00004BCD9C_9606-17 P35968 P35968
URS00004BCD9C_9606-18 P46937 P46937
URS00004BCD9C_9606-47 P46937 P46937
URS00004BCD9C_9606-19 P52926 P52926
URS00004BCD9C_9606-48 P52926 P52926
URS00004BCD9C_9606-20 P56817 P56817
URS00004BCD9C_9606-49 P56817 P56817
URS00004BCD9C_9606-50 Q15078 Q15078
URS00004BCD9C_9606-21 Q15078 Q15078
URS00004BCD9C_9606-22 Q8N5C8 Q8N5C8
URS00004BCD9C_9606-23 Q92542 Q92542
URS00004BCD9C_9606-51 Q92542 Q92542
URS00004BCD9C_9606-24 Q9BW30 Q9BW30
URS00004BCD9C_9606-52 Q9BW30 Q9BW30
URS00004BCD9C_9606-53 Q9UN37 Q9UN37
URS00004BCD9C_9606-25 Q9UN37 Q9UN37
URS00004BCD9C_9606-28 Q9Y243 Q9Y243
URS00004BCD9C_9606-54 Q9Y243 Q9Y243

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Daubentonia madagascariensis dma-miR-16
    11. Equus caballus eca-miR-16
    12. Gorilla gorilla (western gorilla) ggo-miR-16
    13. Lagothrix lagotricha lla-miR-16
    14. Macaca mulatta mml-miR-16-5p
    15. Macaca nemestrina (pig-tailed macaque) mne-miR-16
    16. Maylandia zebra mze-miR-16a
    17. Monodelphis domestica mdo-miR-16-5p
    18. Mus musculus (house mouse) mmu-miR-16-5p
    19. Nomascus leucogenys nle-miR-16
    20. Oreochromis niloticus oni-miR-16a
    21. Ornithorhynchus anatinus oan-miR-16a-5p
    22. Otolemur garnettii oga-miR-16
    23. Ovis aries miscellaneous RNA
    24. Pan paniscus (pygmy chimpanzee) ppa-miR-16
    25. Pan troglodytes ptr-miR-16
    26. Papio hamadryas pha-miR-16
    27. Petromyzon marinus Pma-Mir-15-P2o1_5p (mature (guide))
    28. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    29. Pteropus alecto (black flying fox) pal-miR-16-5p
    30. Rattus norvegicus rno-miR-16-5p
    31. Saguinus labiatus sla-miR-16
    32. Saimiri boliviensis boliviensis sbo-miR-16
    33. Salmo salar ssa-miR-16c-5p
    34. Sarcophilus harrisii Sha-Mir-15-P2a_5p (mature (guide))
    35. Scyliorhinus torazame Sto-Mir-15-P2b_5p (mature (guide))
    36. Sus scrofa (pig) ssc-miR-16
     Publications