Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-16-5p URS00004BCD9C_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (GeneCards, IntAct, miRBase, LncBase, ENA, RefSeq, MirGeneDB, MalaCards, TarBase). Described in 114 papers. Homo sapiens (human) hsa-miR-16-5p sequence is a product of miR-16-5p, hsa-miR-16, MIR16-2, 16, hsa-miR-16-5p, MIR16-1, miR-16 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 15E1.2, 16.3A5, 16A.

Interactions 15

According to IntAct, Homo sapiens (human) hsa-miR-16-5p interacts with:

IntAct ID Participant Synonyms
EBI-21006461 intact:EBI-20558883 EBI-20558883 ENST00000372067.7 mrna_vegfa
EBI-20976618 intact:EBI-20976621 EBI-20976621 ENST00000346798 mrna_app
EBI-20976615 intact:EBI-20976628 EBI-20976628 ENST00000313005 mrna_bace
EBI-20994120 intact:EBI-20994123 EBI-20994123 ENST00000217086 mrna_sall4
EBI-21001375 intact:EBI-21001378 EBI-21001378 ENST00000460006 mrna_cds2
EBI-21001502 intact:EBI-21001511 EBI-21001511 ENST00000354570 mrna_map7
EBI-21001496 intact:EBI-21001532 EBI-21001532 ENST00000228437 mrna_prdm4
EBI-21003198 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21003080 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21003215 intact:EBI-21003141 EBI-21003141 ENST00000361735 mrna_mettl13
EBI-21014055 intact:EBI-21014057 EBI-21014057 ENSMUST00000025263.14 mrna_tnfalfa
EBI-21014565 intact:EBI-21014454 EBI-21014454 ENSMUST00000102796.9 mrna_il12p40
EBI-21014878 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-21015270 intact:EBI-21015273 EBI-21015273 ENST00000376663.7 mrna_bmi1
EBI-21015638 intact:EBI-21015273 EBI-21015273 ENST00000376663.7 mrna_bmi1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Ateles geoffroyi age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Daubentonia madagascariensis dma-miR-16
    11. Equus caballus eca-miR-16
    12. Gorilla gorilla ggo-miR-16
    13. Lagothrix lagotricha lla-miR-16
    14. Macaca mulatta mml-miR-16-5p
    15. Macaca nemestrina mne-miR-16
    16. Maylandia zebra (zebra mbuna) mze-miR-16a
    17. Monodelphis domestica mdo-miR-16-5p
    18. Mus musculus mmu-miR-16-5p
    19. Nomascus leucogenys nle-miR-16
    20. Oreochromis niloticus (Nile tilapia) oni-miR-16a
    21. Ornithorhynchus anatinus oan-miR-16a-5p
    22. Otolemur garnettii (small-eared galago) oga-miR-16
    23. Ovis aries (sheep) miscellaneous RNA
    24. Pan paniscus ppa-miR-16
    25. Pan troglodytes ptr-miR-16
    26. Papio hamadryas (hamadryas baboon) pha-miR-16
    27. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    28. Pteropus alecto pal-miR-16-5p
    29. Rattus norvegicus rno-miR-16-5p
    30. Saguinus labiatus (red-chested mustached tamarin) sla-miR-16
    31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-16
    32. Salmo salar (Atlantic salmon) ssa-miR-16c-5p
    33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2a_5p (mature (guide))
    34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide))
    35. Sus scrofa ssc-miR-16