Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide)) URS00004BCD9C_75743

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Ateles geoffroyi age-miR-16
  2. Callithrix jacchus cja-miR-16
  3. Callorhinchus milii (elephant shark) eshark_mir-15_1
  4. Canis lupus familiaris (dog) cfa-miR-16
  5. Capra hircus (goat) miR-16
  6. Cervus elaphus (red deer) cel-miR-16b
  7. Chrysemys picta bellii Cpi-Mir-15-P2a_5p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-16a-5p
  9. Cricetulus griseus cgr-miR-16-5p
  10. Daubentonia madagascariensis dma-miR-16
  11. Equus caballus (horse) eca-miR-16
  12. Gorilla gorilla gorilla ggo-miR-16 (MIR16)
  13. Gorilla gorilla (western gorilla) ggo-miR-16
  14. Homo sapiens (human) hsa-miR-16-5p
  15. Lagothrix lagotricha lla-miR-16
  16. Macaca mulatta (Rhesus monkey) mml-miR-16-5p
  17. Macaca nemestrina mne-miR-16
  18. Maylandia zebra (zebra mbuna) mze-miR-16a
  19. Monodelphis domestica mdo-miR-16-5p
  20. Mus musculus mmu-miR-16-5p
  21. Nomascus leucogenys nle-miR-16
  22. Oreochromis niloticus (Nile tilapia) oni-miR-16a
  23. Ornithorhynchus anatinus (platypus) oan-miR-16a-5p
  24. Otolemur garnettii oga-miR-16
  25. Ovis aries (sheep) miscellaneous RNA
  26. Pan paniscus ppa-miR-16
  27. Pan troglodytes (chimpanzee) ptr-miR-16
  28. Papio hamadryas pha-miR-16
  29. Petromyzon marinus Pma-Mir-15-P2o1_5p (mature (guide))
  30. Pongo pygmaeus microRNA mir-16-1
  31. Pteropus alecto (black flying fox) pal-miR-16-5p
  32. Rattus norvegicus rno-miR-16-5p
  33. Saguinus labiatus sla-miR-16
  34. Saimiri boliviensis boliviensis sbo-miR-16
  35. Salmo salar (Atlantic salmon) ssa-miR-16c-5p
  36. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2a_5p (mature (guide))
  37. Sus scrofa ssc-miR-16