Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-16-5p URS00004BCD9C_10116

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Rattus norvegicus. Annotated by 5 databases (miRBase, PirBase, IntAct, MirGeneDB, RefSeq). Rattus norvegicus (Norway rat) rno-miR-16-5p sequence is a product of Mir16, rno-miR-16, miR-16, rno-miR-16-5p, miR-16-5p genes. Found in the Rattus norvegicus reference genome.

Interactions 3

According to PSICQUIC and IntAct, Rattus norvegicus (Norway rat) rno-miR-16-5p interacts with:

Interaction id Participant Synonyms
URS00004BCD9C_10116-0 F1LNV0 F1LNV0
URS00004BCD9C_10116-1 G3V8V0 G3V8V0
EBI-21016186 Q9QZ81 Ago2 Argonaute RISC catalytic component 2 EBI-9527129 Eif2c2 Eukaryotic translation initiation factor 2C 2 Golgi ER protein 95 kDa Protein slicer Q9QZ81 ago2_rat

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Daubentonia madagascariensis dma-miR-16
    11. Equus caballus eca-miR-16
    12. Gorilla gorilla (western gorilla) ggo-miR-16
    13. Homo sapiens hsa-miR-16-5p
    14. Lagothrix lagotricha lla-miR-16
    15. Macaca mulatta mml-miR-16-5p
    16. Macaca nemestrina (pig-tailed macaque) mne-miR-16
    17. Maylandia zebra mze-miR-16a
    18. Monodelphis domestica mdo-miR-16-5p
    19. Mus musculus (house mouse) mmu-miR-16-5p
    20. Nomascus leucogenys nle-miR-16
    21. Oreochromis niloticus oni-miR-16a
    22. Ornithorhynchus anatinus oan-miR-16a-5p
    23. Otolemur garnettii oga-miR-16
    24. Ovis aries miscellaneous RNA
    25. Pan paniscus (pygmy chimpanzee) ppa-miR-16
    26. Pan troglodytes ptr-miR-16
    27. Papio hamadryas pha-miR-16
    28. Petromyzon marinus Pma-Mir-15-P2o1_5p (mature (guide))
    29. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    30. Pteropus alecto (black flying fox) pal-miR-16-5p
    31. Saguinus labiatus sla-miR-16
    32. Saimiri boliviensis boliviensis sbo-miR-16
    33. Salmo salar ssa-miR-16c-5p
    34. Sarcophilus harrisii Sha-Mir-15-P2a_5p (mature (guide))
    35. Scyliorhinus torazame Sto-Mir-15-P2b_5p (mature (guide))
    36. Sus scrofa (pig) ssc-miR-16
    Publications