Daphnia pulex (common water flea) dpu-miR-263a

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daphnia pulex (common water flea) dpu-miR-263a URS00004B2F84_6669

21 nucleotides
1 database (miRBase)
Found in 3 other species
3 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAUGGCACUGGAAGAAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Bombyx mori bmo-miR-263a-5p
Ixodes scapularis (black-legged tick) isc-miR-263a
Mus musculus Mus_musculus piRNA piR-mmu-49117243

Publications