Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1a_3p* (star (passenger)) URS00004B2A47_59729

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCAGAUGUUUGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-30-P1a_3p* (star (passenger))
  2. Anolis carolinensis Aca-Mir-30-P1a_3p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-30-P1a_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-30-P1a_3p* (star (passenger))
  5. Canis lupus familiaris Cfa-Mir-30-P1a_3p* (star (passenger))
  6. Cavia porcellus cpo-miR-30d-3p
  7. Cervus elaphus Cel-miR-30d*
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P1a_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-30d-3p
  10. Columba livia (rock pigeon) cli-miR-30d-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-30d
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30d-3p
  13. Equus caballus (horse) Eca-Mir-30-P1a_3p* (star (passenger))
  14. Gallus gallus (chicken) Gga-Mir-30-P1a_3p* (star (passenger))
  15. Gekko japonicus Gja-Mir-30-P1a_3p* (star (passenger))
  16. Homo sapiens hsa-miR-30d-3p
  17. Lepisosteus oculatus (spotted gar) Loc-Mir-30-P1a_3p* (star (passenger))
  18. Loxodonta africana (African savanna elephant) Laf-Mir-30-P1a_3p* (star (passenger))
  19. Macaca mulatta Mml-Mir-30-P1a_3p* (star (passenger))
  20. Microcaecilia unicolor Mun-Mir-30-P1a_3p* (star (passenger))
  21. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P1a_3p* (star (passenger))
  22. Monodelphis domestica mdo-miR-30e-3p
  23. Mus musculus (house mouse) mmu-miR-30d-3p
  24. Notamacropus eugenii (tammar wallaby) Neu-Mir-30-P1a_3p* (star (passenger))
  25. Oryctolagus cuniculus (rabbit) ocu-miR-30d-3p
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P1a_3p* (star (passenger))
  27. Pteropus alecto (black flying fox) pal-miR-30d-3p
  28. Rattus norvegicus (Norway rat) rno-miR-30d-3p
  29. Sarcophilus harrisii Sha-Mir-30-P1a_3p* (star (passenger))
  30. Sphenodon punctatus (tuatara) Spt-Mir-30-P1a_3p* (star (passenger))
Relationships

Molecular Relationships