Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-30d-3p URS00004B2A47_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCAGAUGUUUGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-30d-3p
  2. Cervus elaphus Cel-miR-30d*
  3. Chrysemys picta (Painted turtle) cpi-miR-30d-3p
  4. Columba livia (rock pigeon) cli-miR-30d-3p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-30d
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30d-3p
  7. Homo sapiens (human) hsa-miR-30d-3p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30e-3p
  9. Mus musculus mmu-miR-30d-3p
  10. Oryctolagus cuniculus ocu-miR-30d-3p
  11. Rattus norvegicus rno-miR-30d-3p