Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3918 URS00004AD450_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3918: Hsa-mir-3918 is a microRNA (miRNA) that has been identified in various studies [PMC9657516]. It has been found to have five miRNA identities in common with other genes, including hsa-miR-4640-5p, hsa-miR-30e-5p, hsa-miR-30a-5p, and hsa-miR-4726-5p [PMC9657516]. Additionally, low expression of hsa-mir-3918 has been associated with a higher survival rate [PMC8321750]. Hsa-mir-3918 has also been identified as one of the miRNAs targeting ARHGAP1 [PMC8028841]. Furthermore, it has been predicted to be a target of the drug nilotinib [PMC8589263]. In the context of cancer research, hsa-mir-3918 is one of the miRNA genes identified as a candidate driver gene in various types of cancer [PMC7648123]. Finally, it has also been reported to regulate cancer-related target genes such as CASR and CDC25B [PMC8240180].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGGGCCGCAGAUGGAGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications