Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-219a-2-3p URS00004ACAAA_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (RefSeq, miRBase, ENA, MirGeneDB, TarBase, MalaCards, GeneCards). Homo sapiens (human) hsa-miR-219a-2-3p sequence is a product of miR-219a-2, MIR219A2, HSA-MIR-RG-82, miR-219a-2-3p, hsa-miR-219a-2-3p, MIR-RG-82, hsa-miR-219a-2 genes. Found in the human reference genome. Interacts with protein-coding genes, including 4.1B, 53BP1, ABAT, AD-004, AIP1, ALFY, ALIEN, ANK2, ANKRD12, ANP32E.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGAAUUGUGGCUGGACAUCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus (cattle) Bta-Mir-219-P2_3p (mature (co-guide))
    2. Callithrix jacchus cja-miR-219
    3. Canis lupus familiaris (dog) cfa-miR-219-3p
    4. Cavia porcellus cpo-miR-219b-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-219b-3p
    6. Echinops telfairi Ete-Mir-219-P2_3p (mature (co-guide))
    7. Latimeria chalumnae Lch-Mir-219-P2_3p (mature (co-guide))
    8. Lepisosteus oculatus Loc-Mir-219-P2_3p (mature (co-guide))
    9. Macaca mulatta (Rhesus monkey) mml-miR-219-3p
    10. Monodelphis domestica mdo-miR-219-1-3p
    11. Mus musculus mmu-miR-219a-2-3p
    12. Oryctolagus cuniculus ocu-miR-219b-3p
    13. Pan troglodytes (chimpanzee) ptr-miR-219-2-3p
    14. Pteropus alecto pal-miR-219a-2-3p
    15. Rattus norvegicus rno-miR-219a-2-3p
    16. Sarcophilus harrisii Sha-Mir-219-P2_3p (mature (co-guide))
    Publications New