Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Latimeria chalumnae (coelacanth) Lch-Mir-219-P2_3p (mature (co-guide)) URS00004ACAAA_7897

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUUGUGGCUGGACAUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus Bta-Mir-219-P2_3p (mature (co-guide))
  2. Callithrix jacchus cja-miR-219
  3. Canis lupus familiaris cfa-miR-219-3p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-219b-3p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-219b-3p
  6. Echinops telfairi Ete-Mir-219-P2_3p (mature (co-guide))
  7. Homo sapiens hsa-miR-219a-2-3p
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-219-P2_3p (mature (co-guide))
  9. Macaca mulatta (Rhesus monkey) mml-miR-219-3p
  10. Monodelphis domestica mdo-miR-219-1-3p
  11. Mus musculus mmu-miR-219a-2-3p
  12. Oryctolagus cuniculus ocu-miR-219b-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-219-2-3p
  14. Pteropus alecto (black flying fox) pal-miR-219a-2-3p
  15. Rattus norvegicus rno-miR-219a-2-3p
  16. Sarcophilus harrisii Sha-Mir-219-P2_3p (mature (co-guide))