Homo sapiens (human) hsa-miR-663a

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-663a URS00004929F1_9606

22 nucleotides
8 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 1 other species
572 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-663a: Hsa-mir-663a is one of the four miRNAs analyzed in the study [PMC9302563]. The study examined the expression levels of hsa-mir-663a, hsa-miR-145-5p, hsa-miR-455-3p, and hsa-miR-940, as well as their target genes TGFB1, RYR1, PIK3R1, and PNMA3 [PMC9302563]. The expression levels were measured using RT-qPCR [PMC9302563]. Among the upregulated miRNAs identified in the study, hsa-mir-663a and hsa-miR-1469 consistently showed increased expression in conditions of leucine deprivation and ATF4 overexpression [PMC9389164].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGCGGGGCGCCGCGGGACCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.