Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-425 URS000048BA36_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGACACGAUCACUCCCGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Capra hircus chi-miR-425-5p
  2. Cricetulus griseus cgr-miR-425-5p
  3. Homo sapiens (human) hsa-miR-425-5p
  4. Macaca mulatta mml-miR-425
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-425-5p
  6. Mus musculus mmu-miR-425-5p
  7. Ornithorhynchus anatinus oan-miR-425-5p
  8. Pan troglodytes ptr-miR-425
  9. Pongo pygmaeus ppy-miR-425
  10. Pteropus alecto pal-miR-425-5p
  11. Rattus norvegicus (Norway rat) rno-miR-425-5p
  12. Sus scrofa (pig) ssc-miR-425-5p
  13. Tupaia chinensis (Chinese tree shrew) tch-miR-425-5p
  14. Xenopus tropicalis xtr-miR-425-5p
Publications