Xenopus tropicalis (tropical clawed frog) xtr-miR-425-5p URS000048BA36_8364

• 23 nucleotides
• 3 databases (miRBase, PirBase, RefSeq)
• Found in 14 other species
• 30 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AAUGACACGAUCACUCCCGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Canis lupus familiaris cfa-miR-425
2. Capra hircus chi-miR-425-5p
3. Cricetulus griseus cgr-miR-425-5p
4. Homo sapiens (human) hsa-miR-425-5p
5. Macaca mulatta mml-miR-425
6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-425-5p
7. Mus musculus mmu-miR-425-5p
8. Ornithorhynchus anatinus oan-miR-425-5p
9. Pan troglodytes ptr-miR-425
10. Pongo pygmaeus ppy-miR-425
11. Pteropus alecto pal-miR-425-5p
12. Rattus norvegicus (Norway rat) rno-miR-425-5p
13. Sus scrofa (pig) ssc-miR-425-5p
14. Tupaia chinensis (Chinese tree shrew) tch-miR-425-5p

Publications Download

• FASTA
• JSON