v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-10a precursor URS000048795E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR10A: MIR10A, a microRNA, has been demonstrated to enhance the metastatic potential of cervical cancer cells by targeting PTEN, as shown in a study by Zeng et al [PMC6398879]. Ulf Ørom, from the University of Copenhagen, reported that MIR10A can interact with the 5' UTR of mRNAs harboring the TOP regulatory motif and can have both negative and positive impacts on their translation [PMC1794424]. In a separate study, it was found that MIR10A exhibited an increase in expression, while other tested miRNAs did not show significant changes [PMC6132736].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUAAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCCGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla microRNA ggo-mir-10a precursor
  2. Pan paniscus microRNA ppa-mir-10a precursor
  3. Pan troglodytes ptr-mir-10a (ENSPTRG00000027667.2)
 Publications